Fast sybr green chemistry

Manufactured by Thermo Fisher Scientific

Sourced in United States, Australia

The Fast SYBR Green chemistry is a real-time PCR reagent used for the detection and quantification of DNA sequences. It provides rapid and sensitive amplification of target DNA through the use of the SYBR Green I dye, which binds to double-stranded DNA and emits fluorescence upon binding. This allows for the monitoring of DNA amplification in real-time during the PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SYBR Green (3216 citations) Fast SYBR Green (158 citations) SYBR green chemistry (119 citations) Fast Green (27 citations) SYBR™ chemistry (4 citations) FAST chemistry (3 citations) Fast SYBR Green detection chemistry system (2 citations) FAST SYBR™ Green detection chemistry (2 citations)

7 protocols using fast sybr green chemistry

Quantitative PCR Analysis of RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from sorted GFP⁺ cells and unsorted cells using illustra RNAspin Mini RNA Isolation kit (GE Healthcare, Little Chalfont, UK). Concentration and purity of RNA were checked using an ND-1000 Nanodrop Spectrophotometer (Nanodrop, Wilmington, DE), comparative amount of RNA was used for first-strand cDNA synthesized with SuperScript III (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions. qPCR was performed with specific primers (Table 4) using Fast Sybr green chemistry (Applied Biosystems, Foster City, CA) on the 7900HT Real Time PCR System (Applied Biosystems).Table 4

Primers for qPCR

Gene name	Primer sequence	Product length, bp	Accession number
Gapdh	F- GCCGATGCCCCCATGTTTGTGAR-GGGTGGCAGTGATGGCATGGAC	178	NM_008084
Adcyap1r1	F-AACGACCTGATGGGCCTAAAR-TGTCATCCAGACTTGGTCCG	153	NM_007407
Vipr1	F-TCAATGGCGAGGTGCAGGCAGR-TGTGTGCTGCACGAGACGCC	127	NM_011703
Vipr2	F- AGGAAGCTGCACTGCACAAGGAAR- GAGCTTGCAGCCAACCCAGGA	159	NM_009511

Kurahashi M., Baker S.A., Kito Y., Bartlett A., Hara M., Takeyama H., Hashitani H, & Sanders K.M. (2022). PDGFRα+ Interstitial Cells are Effector Cells of PACAP Signaling in Mouse and Human Colon. Cellular and Molecular Gastroenterology and Hepatology, 14(2), 357-373.

+ Open protocol

+ Expand

RNA Isolation and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from sorted CD45⁻CD140a⁺ cells and unsorted cells using illustra RNAspin Mini
RNA Isolation kit (GE Healthcare, Little Chalfont, UK). Concentration and
purity of RNA were checked using an ND-1000 Nanodrop Spectrophotometer
(Nanodrop, Wilmington, DE, USA), comparative amount of RNA were used for
first-strand cDNA synthesized with SuperScript III (Invitrogen, Carlsbad,
CA, USA), according to the manufacturer’s instructions. PCR was
performed with specific primers (Supplementary table 1) with
Go-Taq Green Master Mix (Promega Corp., Madison, WI, USA). PCR products were
analyzed on 2% agarose gels and visualized by ethidium bromide. qRT-PCR was
performed with the same primers as PCR using Fast Sybr green chemistry
(Applied Biosystems, Foster City, CA, USA) on the 7900HT Real Time PCR
System (Applied Biosystems).

Kurahashi M., Kito Y., Baker S., Jennings L.K., Dowers J.G., Koh S.D, & Sanders K.M. (2020). A novel post-synaptic signal pathway of sympathetic neural regulation of murine colonic motility. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(4), 5563-5577.

+ Open protocol

+ Expand

Quantification of Skeletal Muscle Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Skeletal muscle total RNA was extracted and purified using the Direct-zol RNA Miniprep Kit (ZYMO Research, Orange, CA). The concentrations of total RNA were measured with a spectrophotometer (NanoDrop, Thermo Fisher Scientific, Wilmington, DE). Genomic DNA contamination was removed by treatment with DNAse and total RNA (4,000 ng) was reverse transcribed into cDNA (High Capacity cDNA Reverse Kit, Applied Biosystems, Foster City, CA). Samples were mixed with Fast SYBR Green chemistry (Applied Biosystems) and gene-specific primers (Table 1) and added into 96-well plates in triplicates. Real-time quantitative PCR (qPCR) was performed on an ABI 7500 Fast Real-time PCR cycler (Applied Biosystems) to amplify samples for 40 cycles at 95°C for 23 s and 60°C for 30 s. Relative mRNA expression levels were calculated using the 2 ^−ΔΔCt comparative method and 18S abundance for normalization, which was not affected by birth weight.

Chen Y., McCauley S.R., Johnson S.E., Rhoads R.P, & El-Kadi S.W. (2017). Downregulated Translation Initiation Signaling Predisposes Low-Birth-Weight Neonatal Pigs to Slower Rates of Muscle Protein Synthesis. Frontiers in Physiology, 8, 482.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis of Muscle Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from frozen ribeye muscle samples utilising the TRIzol™ Plus RNA Purification Kit (Invitrogen, Thermo Fisher Scientific, Victoria, Australia), and subsequently purified and DNase-treated with ezDNase™ Enzyme (Thermo Fisher Scientific, Victoria, Australia). Total RNA yield and quality were checked with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Victoria, Australia) and QuantiFluor® RNA System (Promega, WI, USA). Complementary DNA was synthesized from 100 ng RNA using SuperScript™ IV VILO™ Master Mix Reverse Transcription Kit (Thermo Fisher Scientific, Victoria, Australia).
Twenty microliters quantitative polymerase chain reaction (qPCR) reactions were run in duplicate utilising the Fast SYBR Green Chemistry (Thermo Fisher Scientific, Victoria, Australia) with 250 nM primers and 6 µL template on a QuantStudio-3 Real-Time qPCR detection system (Applied Biosystem Inc.). This was carried out under fast-cycling settings of initial 50 °C for 2 min, then 95 °C for 2 min, then 50 cycles at 95 °C for 15s and finally 65 °C for 1 min.

Otto J.R., Pewan S.B., Edmunds R.C., Mwangi F.W., Kinobe R.T., Adegboye O.A, & Malau-Aduli A.E. (2023). Differential expressions of FASN, SCD, and FABP4 genes in the ribeye muscle of omega-3 oil-supplemented Tattykeel Australian White lambs. BMC Genomics, 24, 666.

+ Open protocol

+ Expand

Quantifying HLA and CIITA Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR assays and primers for the quantification of HLA-A, HLA-C, HLA-DRB, HLA-DPB1, and CIITA transcripts were developed in- house as previously reported (3 (link)). For all reactions, 30 ng of total RNA was retrotranscribed with the iScript cDNA synthesis kit (Bio-Rad; cat. #1708891) according to the manufacturer's instructions. The synthetized cDNA was then preamplified using TaqMan PreAmp Master Mix (Thermo Fisher Scientific; cat. #4488593). Gene expression levels were measured by real-time quantitative PCR (RT-qPCR) on a Viia7 Real-Time PCR System (Applied Biosystems) using Fast SYBR Green chemistry (Thermo Fisher Scientific; cat. #4385618). The relative expression of each target gene was first normalized to RNaseP or GUSB reference genes (ΔC_T) and then as fold changes (ΔΔC_T) relative to the indicated control conditions.

Gambacorta V., Beretta S., Ciccimarra M., Zito L., Giannetti K., Andrisani A., Gnani D., Zanotti L., Oliveira G., Carrabba M.G., Cittaro D., Merelli I., Ciceri F., Di Micco R, & Vago L. (2022). Integrated Multiomic Profiling Identifies the Epigenetic Regulator PRC2 as a Therapeutic Target to Counteract Leukemia Immune Escape and Relapse. Cancer Discovery, 12(6), 1449-1461.

+ Open protocol

+ Expand

qPCR Gene Expression Analysis in Glioma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from freshly harvested GL261 gliomas and lymphocytes from immunized and control mice and used for gene expression analysis. RNA was extracted with TRIzol reagent (Life Technologies) using the RNeasy MINI KIT (Qiagen) and the RNase-Free DNase Set (Qiagen). cDNA was synthesized from total RNA using oligo (dT) and M-MLV Reverse Transcriptase (Life Technologies). Specific primers for target genes were designed for Fast SYBR Green chemistry (Life Technologies) and purchased from Primm S.r.l. The relative mRNA levels were evaluated using a ViiA-7 Real-Time PCR System (Life Technologies) and calculated using the ΔΔCt method. The expression levels of the target genes were normalized to the expression level of beta-actin (see oligo sequences in Additional file 1).

Pellegatta S., Valletta L., Corbetta C., Patanè M., Zucca I., Riccardi Sirtori F., Bruzzone M.G., Fogliatto G., Isacchi A., Pollo B, & Finocchiaro G. (2015). Effective immuno-targeting of the IDH1 mutation R132H in a murine model of intracranial glioma. Acta Neuropathologica Communications, 3, 4.

+ Open protocol

+ Expand

Transcriptional Profiling of NK and CD8+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from purified NK and CD8⁺ T cells was extracted with TRIzol reagent (Life Technologies) using RNeasy Mini Kit and RNase-Free DNase Set (Qiagen). Microarray analyses were performed after three TMZ or DMSO administrations. Mouse Gene 2.0 ST Array GeneChip (Affymetrix), which includes 35,240 mouse transcripts, was used following standard procedures. Differentially expressed genes were identified using a fold-change threshold ≥ 2 for all transcript comparisons. The functional annotation of genes that passed the FC and expression signal cut-offs was performed using the Gene Ontology (GO) Biological Process category. Fast SYBR Green chemistry (Life Technologies) was used for real-time PCR expression analyses. Relative mRNA levels were measured using a ViiA7 Real Time-PCR System (Life Technologies) and calculated using the ΔΔCt method normalizing to the housekeeping Gapdh, Actin and β2M levels. The primer sequences (Primm S.r.l.) are reported in Supplemental Materials.

Pessina S., Cantini G., Kapetis D., Cazzato E., Di Ianni N., Finocchiaro G, & Pellegatta S. (2015). The multidrug-resistance transporter Abcc3 protects NK cells from chemotherapy in a murine model of malignant glioma. Oncoimmunology, 5(5), e1108513.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!