Perfcta sybr green fastmix

HUVECs and HDLECs were grown to confluency in a pregelatinized six-well dish. Total RNA was isolated using the RNeasy Mini Kit (Qiagen), and 1 µg of total RNA was transcribed into cDNA using Superscript III Reverse Transcriptase (Thermo Fisher Scientific). Quantitative real-time PCR was performed using PerfCTa SYBR Green FastMix (Quanta Biosciences) on a Bio-Rad CFX96 System. Gene expression values of ERG in HUVECs and HDLECs were normalized to GAPDH expression and compared using the ΔΔC_T method. The following oligonucleotides were used: ERG, 5′-GGAGTGGGCGGTGAAAGA-3′ and 5′-AAGGATGTCGGCGTTGTAGC-3′; GAPDH, 5′-CAAGGTCATCCATGACAACTTTG-3′ and 5′-GGGCCATCCACAGTCTTCTG-3′.

RNA was isolated from cells using RNeasy (QIAGEN, ON) kits, while cDNAs were synthesized using qScript kits (Quanta Biosciences, MD), according to the supplier’s specifications. qRT-PCR reactions were performed using PerfCTa SYBR Green FastMix (Quanta Biosciences) with the appropriate primers in a C1000 Touch (BioRad, Mississauga, ON) thermocycler. Primers sequences were: IL10 forward AAGCCTTATCGGAAATGATCCA, reverse GCTCCACTGCCTTGCTCTTATT; IL12p35 forward GCCCTCCTAAACCACCTCAGT, reverse CAGGCAACTCTCGTTCTTGTGTA; and β-actin forward CCAGAGCAAGAGAGGCATCC, reverse CAACTGTCTCCATGTCGTCC. Data was analyzed using the software program CFX Manager (BioRad) and were normalized relative to β-actin mRNA levels.