Phosphate buffered saline (PBS), 5-Nicotinamide adenine dinucleotide phosphate reduced (NADPH), 2,2-diphenyl-1-picrylhydrazyl (DPPH), fetal bovine serum (FBS), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonicacid) diammonium salt (ABTS) and Dulbecco's modified eagle medium (DMEM), trichloroaceticacid (TCA), thiobarbituricacid (TBA), folin ciocalteau and trypsin were procured from Hi-Media Labs Pvt. Ltd (Mumbai, India). 3-(4, 5-dimethylthiazol-2-yl)-5-diphenyltetrazolium bromide (MTT) and Silymarin were procured from Sigma Aldrich (MO, USA). Kits for serum aspartate aminotransferase (AST), alanine aminotransaminase (ALT), alkaline phosphatase (ALP), total protein (TP) and total bilirubin (TB) were procured from Erba diagnostic (Mannheim, Germany). All other chemicals used were analytical grade and obtained from Sigma-Aldrich (MO, USA), Merck (Bangalore, India) and Sd Fine Chem (Mumbai, India). Tri reagent from G Biosciences (St. Louis, USA), oligo dT primer from Eurofins (Bangalore, India), Revert Aid Reverse Transcriptase (Thermo scientific, India), polymerase chain reaction (PCR) master mix from Aristogene (Bangalore, India), Rodent pellet diet from Gold Mohr (Lipton India Ltd, Bangalore, India), Rat (BRL3A) liver cell line was acquired from National Centre for Cell Science (Pune, India).
Oligo dt primer
Manufactured by Eurofins
Sourced in Germany
Oligo-dT-primers are short sequences of deoxythymidine nucleotides used in molecular biology applications. They are designed to specifically bind to the poly(A) tail of mRNA molecules, enabling the selective isolation and reverse transcription of eukaryotic mRNA.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 2 cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Mir oligodt primer, by Eurofins (2 mentions)
Tri reagent, by Merck Group (2 mentions)
M mlv rt h, by Thermo Fisher Scientific (2 mentions)
Lightcycler, by Roche (2 mentions)
Platinum sybr green qpcr supermix udg, by Thermo Fisher Scientific (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Revertaid h minus reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Silymarin, by Merck Group (1 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
3 4 5 dimethyl thiazol 2 yl 5 diphenyl tetrazolium bromide mtt, by Merck Group (1 mentions)
Rnaseout, by Thermo Fisher Scientific (1 mentions)
Omniscript rt kit, by Qiagen (1 mentions)
Chromo 4 thermocycler, by Bio-Rad (1 mentions)
Random primer, by Roche (1 mentions)
Mlv reverse transcriptase, by Promega (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Qiagen (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Avantor (1 mentions)
Brilliant 3 sybr green qpcr master mix, by Agilent Technologies (1 mentions)
9 protocols using oligo dt primer
1
In Vitro Hepatoprotective Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
Phosphate buffered saline (PBS), 5-Nicotinamide adenine dinucleotide phosphate reduced (NADPH), 2,2-diphenyl-1-picrylhydrazyl (DPPH), fetal bovine serum (FBS), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonicacid) diammonium salt (ABTS) and Dulbecco's modified eagle medium (DMEM), trichloroaceticacid (TCA), thiobarbituricacid (TBA), folin ciocalteau and trypsin were procured from Hi-Media Labs Pvt. Ltd (Mumbai, India). 3-(4, 5-dimethylthiazol-2-yl)-5-diphenyltetrazolium bromide (MTT) and Silymarin were procured from Sigma Aldrich (MO, USA). Kits for serum aspartate aminotransferase (AST), alanine aminotransaminase (ALT), alkaline phosphatase (ALP), total protein (TP) and total bilirubin (TB) were procured from Erba diagnostic (Mannheim, Germany). All other chemicals used were analytical grade and obtained from Sigma-Aldrich (MO, USA), Merck (Bangalore, India) and Sd Fine Chem (Mumbai, India). Tri reagent from G Biosciences (St. Louis, USA), oligo dT primer from Eurofins (Bangalore, India), Revert Aid Reverse Transcriptase (Thermo scientific, India), polymerase chain reaction (PCR) master mix from Aristogene (Bangalore, India), Rodent pellet diet from Gold Mohr (Lipton India Ltd, Bangalore, India), Rat (BRL3A) liver cell line was acquired from National Centre for Cell Science (Pune, India).
+ Expand
Phosphate buffered saline (PBS), 5-Nicotinamide adenine dinucleotide phosphate reduced (NADPH), 2,2-diphenyl-1-picrylhydrazyl (DPPH), fetal bovine serum (FBS), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonicacid) diammonium salt (ABTS) and Dulbecco's modified eagle medium (DMEM), trichloroaceticacid (TCA), thiobarbituricacid (TBA), folin ciocalteau and trypsin were procured from Hi-Media Labs Pvt. Ltd (Mumbai, India). 3-(4, 5-dimethylthiazol-2-yl)-5-diphenyltetrazolium bromide (MTT) and Silymarin were procured from Sigma Aldrich (MO, USA). Kits for serum aspartate aminotransferase (AST), alanine aminotransaminase (ALT), alkaline phosphatase (ALP), total protein (TP) and total bilirubin (TB) were procured from Erba diagnostic (Mannheim, Germany). All other chemicals used were analytical grade and obtained from Sigma-Aldrich (MO, USA), Merck (Bangalore, India) and Sd Fine Chem (Mumbai, India). Tri reagent from G Biosciences (St. Louis, USA), oligo dT primer from Eurofins (Bangalore, India), Revert Aid Reverse Transcriptase (Thermo scientific, India), polymerase chain reaction (PCR) master mix from Aristogene (Bangalore, India), Rodent pellet diet from Gold Mohr (Lipton India Ltd, Bangalore, India), Rat (BRL3A) liver cell line was acquired from National Centre for Cell Science (Pune, India).
2
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the GenElute™ mammalian total RNA miniprep kit according to the manufacturer’s instructions. Reverse transcription of 0.5 μg RNA per sample with 1 μM oligo dT primer (MWG Eurofins) and 1 U/ml RNaseOUT (Life Technologies; ThermoFisher) was performed with the OmniscriptRT kit (Qiagen, Manchester, UK) in a total reaction volume of 20 μl for 1 h (37°C). Real-time PCR using SYBR® Green JumpStart™ Taq ReadyMix™ with MgCl2 was performed in a Chromo4 thermocycler (Bio-Rad, Hemel Hempstead, UK) using primers listed in supplementary Table 2. Data were processed using Opticon Monitor 3 software and normalized to the validated reference gene, GAPDH.
3
Small RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TriReagent (Sigma) as per the manufacturer's protocol. It was subjected to DnaseI treatment followed by small RNA enrichment by 4 M LiCl method as given in (Kansal et al. 2015) (link). For cDNA synthesis, 2 μg of RNA was incubated with 100 pmoles of either oligodT primer (Eurofins Genomics) for total RNA or miR_oligodT primer (Eurofins Genomics) for small RNA using the SuperscriptII cDNA synthesis kit (Invitrogen). All the primers have been enlisted in Supplementary Table S1.
4
RNA Isolation, DNase Treatment, and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TriReagent (Sigma) as per the protocol of the manufacturer. It was subjected to DNaseI treatment followed by small RNA enrichment by the 4M LiCl method as given in Kansal et al. (2015 (link)). For cDNA synthesis, 2 μg of RNA was incubated with 100 pmoles of either oligodT primer (Eurofins Genomics) for total RNA or miR_oligodT primer (Eurofins Genomics) for small RNA using the SuperscriptII cDNA synthesis kit (Invitrogen). All the primers have been enlisted in Supplementary Table 1 .
5
Transcriptome Analysis with Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol (Invitrogen) and stored at -80 °C prior to transcription. One microgram of RNA was transcribed with MLV reverse transcriptase (Promega) using random primers (Roche) and oligo-dT primers (Eurofins-MWG). Real-time PCR was performed with exon-spanning primers for tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (Ywhaz) and intron-spanning primers for succinate dehydrogenase complex, subunit A, flavoprotein (Sdha) as internal controls (Gubern et al., 2009 (link)), and intron-spanning primers for Zfp580, Igf1 or Igfp3 using SYBR Green (Qiagen). For primer sequences, see Table 1 . Comparable primer efficiency was confirmed. Melting curves were analyzed for all runs. Experiments in the absence of a template and those with untranscribed RNA served as negative controls. The ddCT method was used to figure out how many fold differences there were in mRNA levels compared to internal control levels.
6
RNA Extraction, Reverse Transcription, and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of RNA was performed using the RNeasy Mini Kit or RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's protocol. Concentration of isolated total RNA was measured by a Nanodrop ND‐1000 spectrophotometer (Peqlab). Equal amounts of RNA were used to synthesize cDNA with the Revert AID H Minus Reverse Transcriptase (Thermo Fisher Scientific) and oligo(dT) primers (Eurofins MWG Operon) according to the manufacturer's protocol. The quantification of cDNA was performed by quantitative real‐time polymerase chain reaction (qRT‐PCR) using the Mx Pro 3005P cycler (Stratagene) and the following primers: GAPDH_fwd 5′‐gcaaattccatggcaccgt‐3′, GAPDH_rev 5′‐gccccacttgattttggagg‐3′, IFNβ_fwd 5′‐tctggcacaacaggtagtaggc‐3′, IFNβ_rev 5′‐gagaagcacaacaggagagcaa‐3′, NS1_fwd 5′‐tgccttctcttccaggacat‐3′, NS1_rev 5′‐ccattcaagtcctccgatg‐3′. The qRT‐PCR reaction mix (Brilliant III SYBR Green QPCR Master Mix) was purchased from Agilent Technologies. Analysis was performed as described earlier (Dudek et al., 2010 ; Dudek et al., 2011 ).
7
RNA Isolation and Quantitative PCR
8
RNA Isolation and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested and total RNA was isolated with the RNeasy Micro Kit (Qiagen, Hilden, Germany). Purified RNA was reverse transcribed with oligo-dT-primers (Eurofins MWG GmbH, Ebersberg, Germany) and reverse transcriptase (M-MLV-RT-H-; Fermentas, Waltham, Mass), according to the manufacturer’s instructions. Quantitative PCR was performed in a Roche LightCycler (Roche, Mannheim, Germany) with Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, Calif). Values were normalized to hypoxanthine phosphoribosyltransferase (HPRT). Primers are listed in Table E1 in this article’s Online Repository at www.jacionline.org .
9
Quantitative Real-Time PCR Analysis of Viral Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative real-time PCR (RT-qPCR), total RNA of infected cells, lung and liver homogenates was isolated as described previously50 (link). Equal amounts of RNA were transcribed into cDNA using Revert AID H Minus Reverse Transcriptase (MBI Fermentas, St. Leon-Rot, Germany) and oligo-(dT)-primers (Eurofins MWG Operon, Ebersberg, Germany) according to the manufacturer’s protocol. Samples were analysed by RT-qPCR on a Stratagene Cycler (Agilent Technologies, Santa Clara, USA) using gene-specific primers (Supplementary Table S6 ) and Brilliant SYBR Green Mastermix (Agilent, Waldbronn, Germany) according to the manufacturer’s instructions. To show reproducibility between experiments and obvious differences between mock-, single- and super-infected samples of IL-6 mRNA levels, raw Ct values of IL-6 in different cell lines are shown in Supplementary Table S7 . Additionally, PCR efficiency was calculated from cDNA of Calu-3 cells61 (link). Relative expression levels were compared with the reference gene Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and calculated according to the 2−ΔΔCt method62 (link). The IV-infected samples were arbitrarily set as 100% and values of other samples were normalised to that value.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!