Tor1a+/+ and Tor1aΔgag/Δgag lines have been previously described (Cascalho et al, 2020 (link)). We targeted Tor1b in the Tor1aΔgag/Δgag line (Tor1aKO) using predesigned Alt‐R® CRISPR‐Cas9 guide RNA (Integrated DNA Technologies) against exon1 (5′‐g GGAACGGCCCCTCAACACGT CGG‐3′), cloned into pX459 V2.0;pSpCas9(BB)‐2A‐Hygro (Addgene #62988, puromycin cassette replaced by hygromycin) according to the Zhang lab protocol (Cong et al, 2013 (link)). Cells were transfected and placed under selection for 2 weeks, and then DNA was extracted and amplified to identify clonal lines carrying frameshift mutations. Additional details are provided in the Appendix. Single plasmids were introduced into TorA/BWT and TorA/BKO MEF lines by electroporation using the T20 program of a Nucleofector™ II/2b device (Lonza), then immediately plated onto coverslips and fixed 24 h later. For shRNA experiments, plasmids containing Ctdnep1 and Nep1r1 shRNA (TRCN0000247433 and TRCN0000253537 (Sigma)) or a scrambled shRNA (gift from David Sabatini (Addgene #1864) were electroporated as above and plated onto coverslips. 48 h later, each coverslip was transfected with 400 ng pcDNA5⁄FRT⁄TO‐Lipin1mGFP using Lipofectamine 2000 and fixed after another 24 h of culturing.
Nucleofector 2 2b device
Manufactured by Lonza
Sourced in United States
The Nucleofector II/2b device is a laboratory instrument designed for the transfection of various cell types, including hard-to-transfect cells. It utilizes electroporation technology to deliver nucleic acids, such as plasmids, RNA, or siRNA, into the cells. The device is capable of optimizing transfection parameters to achieve high efficiency and cell viability.
Automatically generated - may contain errors
Lab products found in correlation
Amaxa mouse macrophage nucleofector kit, by Lonza (2 mentions)
Cell line solution kit 5, by Lonza (1 mentions)
Pdsred2 mito, by Takara Bio (1 mentions)
Nucleofector solution, by Lonza (1 mentions)
Trypsin edta solution, by Thermo Fisher Scientific (1 mentions)
Mouse macrophage nucleofector kit, by Lonza (1 mentions)
6 protocols using nucleofector 2 2b device
1
Genetic Manipulation of Tor Proteins
2
GSK3β Silencing in CLL Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To downregulate GSK3β expression, CLL cells were transfected using the Amaxa nucleofection technology and the ON-TARGETplus SMARTpool small interfering RNA (siRNA) to GSK3β (siGSK3β) or ON-TARGETplus siCONTROL nontargeting pool (siCtrl) as negative control (Dharmacon RNA Technologies). CLL cells (12 × 106) were resuspended in 100 µl Cell Line Solution Kit V (Lonza Group Ltd) with 0.25 μM of siGSK3β or siCtrl, transferred to the cuvettes and transfected with the Amaxa Nucleofector II/2b device (program U-013). Cells were immediately transferred into 12-well plates in complete medium, and after 48 h were examined for the expression of N1-ICD, and GSK3β protein to verify the efficiency of silencing.
3
Transfection of Primary Retinal Ganglion Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pDsRed2-Mito was obtained from Clontech (Mountain View, CA, USA) and the pcDNA3-DRP1K38A plasmid in baculovirus expression vector (US National Center for Biotechnology Information accession number NM_005690.3) was provided by Dr AM van der Bliek. For transfection of primary RGCs, 100 μl of Nucleofector Solution (Lonza, Allendale, NJ, USA) was mixed with 1 × 106 cells and then 1 μg of pcDNA3 and pcDNA3-DRP1 were transfected using a Nucleofector II/2b Device (Lonza).
4
Gene Silencing in Myeloid Progenitor Cells
5
Murine Bone Marrow-Derived Macrophage Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT or CMV-IL-33KO BMDMs were cultured for three days followed by enzymatic and mechanic detachment using 1X trypsin/EDTA solution (Thermofisher). As described in the literature85 (link), BMDMs were transfected with 3μg of empty mCherry- or IL-33-mCherry plasmid generated by VectorBuilder. Transfections were performed using Amaxa® Mouse Macrophage Nucleofector® Kit and Nucleofector II/2b device (Lonza) following manufacturer’s procedures and cells were plated in DMEM-F12 media supplemented with 10%FBS and 20% supernatant derived from CMG14–12 (M-CSF producing) cell line. Two days post-transfection, mCherry plasmid and LPS-induced cytokine expression was determined by flow cytometry. IL-33 in the supernatant was also determined by ELISA (R&D systems).
6
Transfection and Knockdown of Tim-3 and Lyn
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMMCs (3 × 106) were transfected with 100 pmol of nonspecific, Tim-3, or Lyn siRNA (GE Healthcare) using the mouse macrophage nucleofector kit (Lonza), Y-001 program, and the Nucleofector II/2b device (Lonza). Transfected cells were collected after 48 h and efficiency of knockdown was determined by Tim-3 staining, followed by flow cytometry. Efficiency of Lyn knockdown was determined by Western blotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!