Abi 3130 sequencer

The determination of the tissue prostate protein N-glycosylation profile was performed using the on-membrane deglycosylation method, as previously described [15 (link)]. In short, the tissue prostate N-glycans were labeled with 8-aminopyrene-1,3,6-trisulphonic acid (Molecular Probes, Eugene, OR, USA), and were subsequently desialylated overnight at 37 °C by the addition of 2 µL 10 mM ammonium acetate pH 5.0 containing 40 mU of Arthrobacter ureafaciens α-2,3/6/8-sialidase. The end volume of the desialylated stock was 10 µL. Then, 2 µL of the desialylated N-glycan samples and a reference maltooligosaccharide ladder (dextran from Leuconostoc mesenteroides, Sigma-Aldrich, St. Louis, MO, USA) were analyzed with a multicapillary electrophoresis-based ABI3130 sequencer (Applied Biosystems, Foster City, CA, USA). The peaks were further analyzed with GeneMapper version 3.7 software (Applied Biosystems, Foster City, CA, USA), and the peak height intensities were normalized to the total intensity of the measured peaks. Different ratios were calculated.

To assess the methylation status of 96 CpG sites located within 54 cancer related genes, the MS-MLPA kits ME001, ME002, ME003 and ME011 were used (MRC-Holland, Amsterdam, The Netherlands, www.mlpa.com). The MS-MLPA assays were performed basically according to manufacturer’s recommendations, introducing subtle modifications (i.e. extended restriction enzyme incubation time, separated ligation and restriction steps) [12 (link)]. The fluorescent-labeled PCR products were separated by capillary electrophoresis in an ABI-3130 sequencer (Applied Biosystems, Foster City, CA, USA) and analyzed by GeneMarker v1.75 software (Softgenetics, State College, PA, USA). This analysis normalizes the data by dividing the peak area of a single probe by the peak areas of control probes. Subsequently, the normalized peaks from the samples were divided by the normalized peaks from controls to obtain the Methylation Dosage Ratio (MDR). A CpG site was considered to be methylated when the MDR observed between sample and control was superior to the cut-off threshold of 8% [15 (link),16 (link)]. Afterwards, DNA methylation data was dichotomized in unmethylated and methylated status.

Genomic DNA extracted from small pieces of clonally propagated hygromycin-resistant rice calli or kanamycin-resistant tobacco calli using Agencourt chloropure (Beckman Coulter) according to the manufacturer's protocol was subjected to cleaved amplified polymorphic sequence (CAPS) analysis. PCR amplifications were performed with KOD FX neo or KOD ONE (TOYOBO) using the primer sets shown in Supplementary Table 1. PCR products were digested with restriction enzyme MfeI for OsALS and NtALS-B, XbaI for OsCly1, and HindIII for NtEPSPS-B and analyzed with MultiNA microchip electrophoresis system (Shimadzu).
PCR fragments derived from CAPS-positive calli or plants were cloned into pCR-BluntII-TOPO (Invitrogen) and subjected to sequence analysis using an ABI3130 sequencer (Applied Biosystems).

High-resolution melting real-time polymerase chain reaction (PCR) using Rotor-Gene Q instrument (QIAGENE) was performed using forward primer (5′ TGACAGACAAGAAGCGAGA 3′) and reverse primer (3′ ATGTGGGTATATTACAGGTG 5′) to amplify the DNA region containing the rs2229857 SNP (126bp) under the following condition: 95°C for 12 minutes followed by 40 cycles of 95°C for 1 second, 61°C for 20 seconds, and 72°C for 20 seconds. The temperature has been raised gradually from 65 to 95°C within 2 minutes. The software Rotor-Gene 6000 series version 1.7 was used to analyze the results. Chi-square test was employed for Hardy–Weinberg equilibrium and comparison of genotype and allele frequencies. Sanger sequencing was used to confirm the accuracy of the detected variant in at least 10%. Following primers designed via Primer 3 software (F: 5′- TGACAGACAAGAAGCGAGA -3′) and (R: 5′- ATGTGGGTATATTACAGGTG -3′) to amplify the region of interest, the PCR products (126bp) were subsequently visualized using 2% agarose gel and bidirectional sequencing was performed by on an ABI 3130 sequencer (Applied Biosystems). The sequences were compared with the ADAR1 gene reference sequence.

In order to compare the enzyme activity of the secreted recombinant MPEs, mannosyl-phosphorylation assays were conducted using 5 μg of total protein obtained from the culture supernatants. Unless specifically described in the text, the assay buffer contained 50 μl of 50 mM Tris-HCl (pH 7.5), 10 mM MnCl₂, 2 mM GDP-mannose (donor substrate), 5 μM M8-APTS (acceptor substrate), and 0.5 mM deoxymannojirimycin. This reaction was typically performed at 30°C for 10 min and was terminated by boiling. The reaction products were analyzed using a DNA sequencer based on a published protocol [9 (link)]. APTS-labeled glycans were loaded onto an ABI 3130 sequencer (Applied Biosystems, USA) equipped with a standard 36 cm capillary array filled with the POP-7 polyacrylamide linear polymer. The resulting electropherogram was analyzed with the GeneMapper software package (Applied Biosystems). To determine the specific enzyme activity (pmol/min/mg), the contents of mannosyl-phosphorylated glycans were calculated based on the normalized ratio of the corresponding peak area [100 x (the areas of mannosyl-phosphorylated glycan peaks)/(total areas of all identified peaks)], as described previously [8 (link)].