The largest database of trusted experimental protocols

Puromycin

Manufactured by Sangon
Sourced in China, United States

Puromycin is a laboratory reagent used for the selection of cells that have been successfully transfected or transduced. It functions as an antibiotic that inhibits protein synthesis, allowing only cells expressing the puromycin resistance gene to survive and proliferate.

Automatically generated - may contain errors

82 protocols using puromycin

1

Enhancing Adenovirus and Lentivirus Infection Efficiency

Check if the same lab product or an alternative is used in the 5 most similar protocols
For all adenovirus infections, polybrene (40 μg/mL, Sigma-Aldrich, St. Louis, MO, USA) was added to the culture medium to enhance the infection efficiency. For lentivirus infection, a selection of puromycin-resistant iTECs was carried out 48 h after transfection by the addition of 3 μg/mL puromycin (Sangon Biotechnology, Shanghai, China). Transfection efficiency was measured using RT-qPCR. All sequence information is provided in Supplementary Table S1.
+ Open protocol
+ Expand
2

Emerin Gene Knockdown using epiCRISPR/Cas9

Check if the same lab product or an alternative is used in the 5 most similar protocols
The epiCRISPR/Cas9 plasmid with Emerin-gRNA was constructed according to the protocol applied by Xie et al [36 (link)]. Two gRNAs targeting Emerin DNA sequence were designed by an online tool (http://crispr.mit.edu/). The epiCRISPR/Cas9 with Emerin-gRNA plasmids were transfected into C2C12 myoblasts when cell confluence was over 70% using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s recommendations. Cells were selected by puromycin (3 μg/mL) (Sangon Biotech) 1 day after transfection. When cell confluence was 50%, puromycin was removed from DMEM supplemented with 10% FBS to let the cells with epiCRISPR/Cas9 plasmids proliferate well. When cell confluence was 90%, they were used for cryopreservation and evaluation of knockdown efficiency by Western blotting.
+ Open protocol
+ Expand
3

Rictor Gene Silencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rictor shRNA was purchased from Addgene (#1853 and #1854, Watertown, MA, USA), and the sequences were as follows: Rictor shRNA1, 5′-CCG GTA CTT GTG AAG AAT CGT ATC TTC TCG AGA AGA TAC GAT TCT TCA CA A GTT TT TTG-3′; Rictor shRNA2, 5′-CGG GCA GCC TTG AAC TGT TTA ACT TCC TGT CAT TAA ACA GTT CAA GGC TGC TTT TTG AAT T-3′. Rictor shRNA plasmids were cotransfected with packing plasmids (psPAX2 and pCMV-VSV-G) into HEK293FT cells. Seventy-two hours after transfection, the supernatant containing the lentivirus particles was collected and added to the cells along with polybrene (10 μg/ml) (#sc-134220 Santa Cruz Biotechnology, Santa Cruz, CA) to generate the Rictor-silenced stable cell line. Twenty-four hours after lentivirus infection, cells were selected in the presence of 1–3 μg/ml puromycin (#A610593, Sangon Biotech, Shanghai, China). The stable clones were then picked, and Rictor expression was validated by western blotting.
+ Open protocol
+ Expand
4

IMM47 Antibody Binding Assay for Siglec-10 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
About 293 T-CD24 cells were cultured in DMEM with 10% fetal bovine serum (Gemini, Cat# 900-108) and 30 μg/ml puromycin (Sangon Biotech, Cat# A610593-0025). Cells were collected and washed once with PBS buffer. A total of 2 × 105 live cells in 25 μl were added to each well. About 25 μl of diluted IMM47 antibodies, starting at 5 μg/ml followed by three-fold dilution concentrations, were added into each well and incubated at 4 °C for 45 min. About 50 μl of the diluted PE-labeled human Siglec-10 (Acrobiosystems, Cat# SI0-HP2E5) solution were added to each well and incubated at 4 °C for 45 min. Wells were rinsed with 200 μl of the PBS buffer three times and resuspended with 120 μl of the PBS buffer. Samples were detected by flow cytometry. GraphPad Prism software was used to analyse the data, and the combination curves were drawn with four parameters.
+ Open protocol
+ Expand
5

Lentiviral Overexpression of FOXO1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral vector Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin was purchased from Shanghai Genechem Company. The FOXO1 Cdna was cloned downstream of the lentiviral vector by homologous recombination. Lentiviral vector FOXO1 was purchased from the Cdna Library of School of Medicine, Shanghai Jiaotong University. Based on the manufacturer’s instruction, plasmids were transfected into cells by using the LipoHigh transfection reagent (Sangon Biotech, E607403) in serum-free Opti-MEM (Thermo Fisher Scientific, 31,985,070). An empty vector was used as a negative control. Then, cells were screened by puromycin (Sangon Biotech, A610593).
+ Open protocol
+ Expand
6

CRISPR-Cas9 Mediated PNPT1 Knockout in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PNPT1 gene was knock out in A549 cell using the CRISPR‐Cas9 System. The gRNA:ATAGTGCTCGCACTTGCAAC (designed in http://crispr.mit.edu) was linked into the CRISPR Cas9 Plasmid (Genscript; Nanjing, China) and transformed into competent cell (Trelief 5α, Tsingke; Beijing, China). Harvested plasmids after 16 h cultivation were transfected into the cells using lipofectamine 3000 (Invitrogen; Carlsbad, CA) according to manufacturer's protocol. Cells were then screened out by 50 µm puromycin (Sangon Biotech) and seeded onto 96‐well plate to cultivate monoclonal cell. The monoclonal cells were selected through subculture and PNPT1 protein expression was examined by Western blot.
+ Open protocol
+ Expand
7

Generation of Knockout and Overexpression Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate GSK3α/β or PD-L1 knockout cancer cell lines, the respective target sequences were cloned into lentiCRISPRv2 vector. Cells were transiently transfected with the recombinant plasmids using Lipo6000 Transfection Reagent (C0526, Beyotime), followed by puromycin (A610593, Sangon) selection. Survived cells were plated in limiting dilution in 96-well plates to isolate single-cell colonies. Knockout of the target genes was confirmed by western blot.
To establish stable cell lines overexpressing PD-L1-v1/v4, CDK13 or RPL22−3×HA, the coding sequences were cloned into pCDH-CMV-MCS-EF1-Puro vector (CD510B-1, System Biosciences). Packaging of lentivirus was carried out in 293T cells by co-transfecting the recombinant plasmids and virus packaging vectors (pMD2.G and psPAX2). Virus-containing medium was concentrated using 3×PEG collection medium. Cells were infected with virus in the presence of 10 µg/mL polybrene and screened by puromycin.
+ Open protocol
+ Expand
8

3T3L1 Preadipocyte Maintenance and Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
3T3L1 preadipocytes (ATCC Cat# CL-173, RRID:CVCL_0123) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% calf serum. The 3T3L1 preadipocyte lines were maintained in 10% calf serum supplemented with puromycin (Sangon, A610593).
+ Open protocol
+ Expand
9

Transfection and Selection of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids were transfected into HEK293T cells using a DNA transfection reagent (#TF201201, Tengyi Biotech, Shanghai, China). After 48 h, the viral supernatants were collected and used to infect cells with polybrene (#H9268, Sigma-Aldrich, Missouri, MO, America). After two days, puromycin (#A610593-0025, Sangon, Shanghai, China) or G418 sulfate (#A600958-0005, Sangon, Shanghai, China) was used to screen for the desired cell lines.
+ Open protocol
+ Expand
10

Stable Knockdown of Mybbp1a and IGFBP5

Check if the same lab product or an alternative is used in the 5 most similar protocols
The target sequences of Mybbp1a (5′-GCUGGUGAAUGUGCUGAAGAUGGCC-3′),
and IGFBP5 (5′-CTCCCATTCTCCAATGACT-3′) were obtained from Shanghai Genechem Co., Ltd. and used to generate stable Mybbp1a or IGFBP5 knockdown cell lines according to the instructions of manufacturer. Cells were selected by puromycin (4 μg/ml) (Sangon, Shanghai, China) for 72 h, and the transfection efficiency was proved by quantifying EGFP fluorescence, RT-PCR and western blotting. Stably transfected Huh7 and HCC-LM3 cells were maintained in the Modified Eagle medium (MEM, Gibco, Grand Island, NY) containing 10% fetal bovine serum (FBS, Gibco) for further study.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!