Nucleofector kit

Bloodstream parasites were cultured in HMI-9 at 37°C with 5% CO₂. Differentiation was induced by resuspending parasites in differentiation medium (DTM) at 4 million cells/mL (69 (link)), adding 6 mM cis-aconitate, and incubating parasites at 27°C. Postdifferentiation parasites were maintained between 1 and 10 million cells/mL. The BDF3-HA/BDF3 knockout (KO) strain was generated from EATRO 1125 AnTat1.1 90:13 (70 (link)). EATRO1125 Antat 1.1 lines were kept at densities below 600,000 cells/mL. The pMOTAG5H BDF3-HA construct (26 (link)) was linearized and introduced into parasites using an Amaxa Nucleofector kit. Correct integration was verified using PCR with the following primers: (i) HA rev (TATGGGTACGCGTAATCAGGCACA) and (ii) upstream Bdf3 5′ UTR for (TGTTGCAGGATATTGTGAGTGA). After this, the pyrFEKO PAC/GFP BDF3 KO construct was linearized and transfected into Bdf3-HA-tagged parasites as described above and verified with the following primers: (i) GFP for (CTACAACAGCCACAAGGTCTAT) and (ii) downstream Bdf3 3′ UTR rev (AAACCGCAAAGTGATGAATGG). The control primers shown in figures are (i) Bdf3 3′ UTR for (CTTGTAGACAGCGGCATGGTTGG) and (ii) downstream Bdf3 3′ UTR rev (AAACCGCAAAGTGATGAATGG).

Mid-log-phase epimastigotes (2 × 10⁷ cells in total) were transfected with 5- to 10-μg portions of overexpression constructs using a Human T-Cell Nucleofector kit and an Amaxa Nucleofector electroporator (program U-033). After transfection, the cells were allowed to recover for 16 to 24 h before the appropriate drug selection (200 μg ml⁻¹ G418). L. donovani transgenic cell lines were generated as previously described (41 (link)) and selected with nourseothricin (100 μg ml⁻¹). In all cases, cloned cell lines were generated by limiting dilution, maintained in selective medium, and removed from drug selection for one passage prior to experiments.

siRNA was introduced into activated non-polarized Th cells by electroporation using a human T-cell Nucleofector Kit and Nucleofector I (Amaxa). Activated Th cells were transfected with 675 pmol of control random siRNA or siRNA for Srebf1, Srebf2 or Pparg (Applied Biosystems), and were cultured for 2 days under non-polarized conditions.

To generate instant overexpression plasmids, the coding sequences of Nrf2, MafG, MafK and HBA were cloned into the pCMV6 vector and pRSC-SFFV-E2A-GFP vector. MafK was also cloned into the pcDNA3.1(+) vector. K562 cells overexpressing HBA, Nrf2, MafG or MafK were produced by electrotransfection using an Amaxa Nucleofector Kit, according to the manufacturer's instructions or by lentiviral transfection. K562 cells transfected with an empty pCMV6 vector or pRSC-SFFV-E2A-GFP were used as controls. shRNAs were designed using the SplashRNA algorithm [26 (link)]. Two different shRNAs each were designed for the human Nrf2, mouse Nrf2 and mouse AHSP genes. ShRNAs targeting GFP or luciferase were used as negative controls. The sequences of the shRNAs are listed in Supplementary Fig. 8.

5X10⁵ FLS (passage 4–6) were transfected with 1–3 μg targeting ELMO1, ELMO2 or scramble (sc) control Smartpool siRNA (Dharmacon, Lafayette, CO), using normal human dermal fibroblast Nucleofector kit, according to the manufacturer’s instruction (Amaxa, Gaithersburg, MD).