Ten EC tissues and 10 normal endometrial tissues were obtained from patients at the Department of Gynecology, Nanjing Drum Tower Hospital. Normal tissues were obtained from individuals who underwent a hysterectomy due to endometrial-irrelevant diseases. All samples were immediately snap-frozen in liquid nitrogen and stored at -80°C until further analysis. Each individual provided informed consent, and this study was approved by the Ethics Committee of Nanjing Drum Tower Hospital. Total RNA of tissues was extracted using TRIzol reagent (Vazyme, Nanjing, China) and TaqMan Reverse Transcription kit (Applied Biosystems) with random hexamer primers was used to reverse-transcribe cDNAs corresponding to the mRNAs of interest. 2×SYBR Green qPCR Master Mix (Selleck, Shanghai, China) was used for qRT-PCR and the housekeeping gene GAPDH was used for normalization of the data before calculation using the ΔΔCt method. The primers used are listed in Table S1 .
Sybr green qpcr master mix
Manufactured by Selleck Chemicals
Sourced in United States, China, Canada, Germany, Japan
2× SYBR Green qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) reactions. It contains all the necessary components, including SYBR Green I dye, DNA polymerase, buffer, and dNTPs, to perform qPCR amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (69 mentions)
Trizol, by Thermo Fisher Scientific (26 mentions)
All in one cdna synthesis supermix, by Selleck Chemicals (24 mentions)
Primescript rt reagent kit, by Takara Bio (21 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (17 mentions)
Trizol reagent, by Takara Bio (14 mentions)
Rnaiso plus, by Takara Bio (13 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (12 mentions)
M mulv reverse transcriptase, by New England Biolabs (10 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (8 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (8 mentions)
Primescript rt master mix, by Takara Bio (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Trizol reagent, by Tiangen Biotech (7 mentions)
Total rna extraction kit, by Solarbio (6 mentions)
Cfx connect unit, by Bio-Rad (6 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (6 mentions)
Reverse transcription kit, by Takara Bio (6 mentions)
Cfx96 real time pcr system, by Bio-Rad (5 mentions)
Cfx connect real time system, by Bio-Rad (5 mentions)
298 protocols using sybr green qpcr master mix
1
Quantifying Endometrial Cancer Transcripts
2
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen). All cDNA was synthesized from 500 ng of total RNA using 5× All-in-One RT Master Mix (Abcam, America). Then, mRNA levels were analyzed by RT-qPCR using 2× SYBR Green qPCR Master Mix (Selleck, cat. no. B21202). The GenBank accession numbers for SPOP and β-actin are AJ000644 and AK025375 , respectively. The β-actin primers were designed to target the nucleotide positions 229–252/398–421, and the SPOP primers were designed to target the nucleotide positions 195–217/278–299. The GenBank accession number for EV71-2A is AB550332 . The EV71-2A primers were designed to target nucleotide positions 48–67/128–147.
The detailed primer sequences were as follows:
EV71-2Apro: 5′-agtggttaaccgccatcttg-3′ and 5′-accttgggcagtggtagatg-3′
SPOP: 5′-gaaatggtgtttgcgagtaaacc-3′ and 5′-gcccgaacttcactctttgga-3′
VP1: 5′-gagtggcagatgtgattga-3′ and 5′-tccagtgtctaagcgatga-3′
β-actin: 5′-accaactgggacgacatggagaaa-3′ and 5′-atagcacagcctggatagcaacg-3′
The detailed primer sequences were as follows:
EV71-2Apro: 5′-agtggttaaccgccatcttg-3′ and 5′-accttgggcagtggtagatg-3′
SPOP: 5′-gaaatggtgtttgcgagtaaacc-3′ and 5′-gcccgaacttcactctttgga-3′
VP1: 5′-gagtggcagatgtgattga-3′ and 5′-tccagtgtctaagcgatga-3′
β-actin: 5′-accaactgggacgacatggagaaa-3′ and 5′-atagcacagcctggatagcaacg-3′
3
Quantification of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were extracted by using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Then the total RNA was treated with DNase Ⅰ (TaKaRa Biomedicals, Tokyo, Japan) to remove residual contamination of genomic DNA, and was purified in accordance with the instruction. For revert transcription, 3 μg of total RNA was reverse-transcribed into cDNA by using RevertAid First Strand cDNA Synthesis Kit (Fermentas, Thermo Fisher Scientific, Inc., Waltham, MA) in accordance with the manufacturer's protocol. Poly(A) tailing, reverse transcription and RT-PCR quantification of miRNAs were performed by using miDETECT A TrackTM miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China) according to the manufacturer's protocol. Primer sets for miRNAs qPCR quantification were purchased from RiboBio Co. (Guangzhou, China). Real-time quantitative PCR reactions with 2× SYBR Green qPCR Master Mix (Selleckchem, Houston, TX, USA) were carried out by CFX96 Two-step Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Relative transcripts expression was calculated with the 2-ΔΔCt method.
4
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from NFs, CAFs, NFs-exo, CAFs-exo, or U937 cells was extracted with TRIzol reagent (Takara, Japan) following the manufacturer's instructions. RNA was reversely transcribed into complementary DNA (cDNA) using the M-MLV Reverse Transcriptase kit (Takara). Real-time PCR was performed using 2 × SYBR Green qPCR Master Mix (Selleck, Houston, Texas, USA) on Applied Biosystems 7300 Real-Time PCR system (Applied Biosystems, CA, USA). Internal control U6 was used for expression data normalization, and the 2−ΔΔCt method was used to calculate relative expression levels. All primers were synthesized from Sangon (Shanghai, China), and primer sequences are listed in Table 1 .
5
Real-Time PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using trizol (Invitrogen, USA). cDNA was synthesized with first strand cDNA synthesis kit (Thermo Scientific, USA). Using 2×SYBR Green qPCR Master Mix (Selleckchem, USA) for real-time PCR and performed on CFX96 Real-Time PCR System (Bio-Rad, USA). Primers were synthesized by BGI Genomics (Shenzhen, China), primer pairs used are shown in supplementary methods.
6
Quantitative RNA Expression Analysis of EC Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 30 RNA later-reserved EC specimens were collected from patients who underwent surgery at Jiangsu Province Women and Children Health Hospital (Nanjing, China) between September 2017 and September 2019. All samples were immediately snap frozen in liquid nitrogen and stored at − 80 °C until further analysis. Total RNA was isolated from fresh-frozen tissues using TRIzol reagent (Invitrogen) from fresh-frozen tissues and transcribed into cDNA using a TaqMan Reverse Transcription kit (Applied Biosystems) with random hexamer primers. qRT-PCR was performed using 2 × SYBR Green qPCR Master Mix (Selleck, Shanghai, China). The housekeeping gene GAPDH was used for normalization of the qRT-PCR data before calculation using the ΔΔCt method and Student’s t-test (two-tailed) was used for the comparison analyses. The primers used are listed in Supplementary Table 2 .
7
Isolating and Analyzing Circular RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from whole-cell lysates or the nuclear and cytoplasmic fractions were isolated using TRNzol reagent (Invitrogen, Carlabad, CA, USA) for cultured cells or using the GeneJET RNA Purification Kit (Invitrogen, Carlabad, CA, USA) for fresh-frozen tissues. For RNase R treatment, 2 μg of total RNA was incubated for 20 min at 37 °C with or without 3 U/μg of RNase R (Epicentre Technologies, Madison, WI) in 1× RNase R reaction buffer, and the resulting RNA was purified using RNeasy MinElute cleaning Kit (Qiagen, Duesseldorf, Germany); this was transcribed into cDNA (Vazyme Biotech, Nanjing, China). Real-time PCR was performed in accordance with the manufacturer’s protocol, using the 2× SYBR Green qPCR Master Mix (Selleck, Shanghai, China). Before calculation using the 2−ΔΔCt method, the GAPDH levels were used to normalize the relative expression levels of circRNA and linear mRNA, and the levels of small nuclear U6 were used to normalize the miRNA expression level. Primers used are as follows:
ASXL1: F: TCAGAGCAATGTTACAGGCCA, R: CTGTTCTCGGCATTTGCCTT;
Circ-ITGA7: F: GTGTGCACAGGTCCTTCCAA, R: TGGAAGTTCTGTGAGGGACG.
ASXL1: F: TCAGAGCAATGTTACAGGCCA, R: CTGTTCTCGGCATTTGCCTT;
Circ-ITGA7: F: GTGTGCACAGGTCCTTCCAA, R: TGGAAGTTCTGTGAGGGACG.
8
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative real-time PCR, the total RNA was isolated from cultured cells with TRIzol (Roche) following manufacturer’s instructions. cDNA was generated from 1 μg of total RNA with the random hexamers and M-MLV reverse transcriptase (Promega). Quantitative real-time PCR was performed with primers and 2× SYBR Green qPCR Master Mix (selleck, B21702) in an MX3000P Stratagene PCR machine. The quantity of sample was calculated using the standard curve method, the relative expression values were normalized against the internal controls, and then we take neuron group as control, the data was graphed using graphpad prism 5. The primers are shown in Supplementary Table S1 .
9
qRT-PCR Analysis of mRNA Expressions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA expressions were detected via qRT-PCR analysis using 2× SYBR Green qPCR Master Mix (Selleck, Houston, TX, USA) in a LightCycler 96 Real-Time PCR System (Roche, Basel, Switzerland). The primer sequences are detailed in Table 1 . The results were calculated using the 2−ΔΔCT method.
10
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from MDBK or HeLa cells was isolated using a Total RNA Extraction Kit (Tengen, China) according to the manufacturer’s instructions. cDNA was synthesized using a Novozymes HiScript III 1st Strand cDNA Synthesis Kit (Novozymes, Beijing, China). quantitative real-time PCR (qRT-PCR) was performed on a Roche LightCycler 480 II with 2× SYBR Green qPCR Master Mix (Selleck, Beijing, China) according to the manufacturer’s instructions. All qRT-PCR experiments were performed in triplicate. Relative gene levels were determined using the method with GAPDH as an internal control. The primers used for qRT-PCR are listed in Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!