Pflag cmv2 vector

Flag-DISC1, Flag-mouse DISC1 (Flag-mDISC1) and Flag-DISC1 fragments were generated in pFlag-cmv2 vector (Sigma-Aldrich). GFP-DISC1, GFP-DISC1 fragments, GFP-EXOC1 and GFP-EXOC1 fragments were generated in pEGFP-C3 vector (Clontech). RFP-EXOC1 was generated in pmCherry-C1 vector (Clontech). GFP-ER made with Arabidopsis Bip ER signal sequence, retention signal and GFP was kindly provided by Inhwan Hwang (Department of Life Sciences, Pohang University of Science and Technology, Korea). shRNA constructs for DISC1 were generated by targeting two sequences (shRNA1: AAGAGTGCAGCAGCCCCTACT, nucleotide positions 301–321; shRNA2: AAGGAAAATACTATGAAGTAC, nucleotide positions 1993–2013). DISC1 shRNA2 was mainly used for human DISC1 knockdown in HEK293 cells. Mouse DISC1 (mDISC1) shRNA used in this study has been described previously10 (link) (AAGGCAAACACTGTGAAGTGC, nucleotide positions 1984–2004). EXOC1 shRNA target sequences were selected according to the report24 (link) (CCCGACTATATGAAAGAGAAA, nucleotide positions 1244–1264 for human exoc1 and 1265–1285 for mouse exoc1 genes).

The FLAG-tagged K18 constructs
were generated by in-frame subcloning the human KRT18 cDNA into the pFLAG-CMV-2 vector (Sigma-Aldrich). The K18 mutants
(S15A, S18A, S15/18A, S30A, S31A, S30/31A and 4A), HA-tagged K18 constructs
(WT and S30A), and FLAG-tagged IDH2 construct (S202A) were generated
using the ClonExpress Ultra One Step Cloning Kit (Vazyme) according
to the manufacturer’s protocol. All constructs were confirmed
by DNA sequencing (Sangon, Shanghai, China). All primers used in plasmid
construction were provided in this study (Table S4).

Flag-CLC-1 was generated by subcloning human CLC-1 into the pFlag-CMV2 vector (Sigma-Aldrich, St. Louis, MO, USA) [18 (link)]. Myc-FKBP8 was created by swapping mouse FKBP8 into the pcDNA3.1-Myc vector (Sigma-Aldrich) [19 (link)]. Additional cDNA constructs employed in this study are pcDNA3.1-Myc mouse Aha1, pcDNA3-HA rat HOP, pcDNA5-V5 human Hsc70 (Addgene 19514, Watertown, MA, USA), pcDNA3-HA human Hsp90β (Addgene 22847), and pEGFP-rat TGN38 (kindly provided by Dr. Fan-Jen Lee, National Taiwan University, Taipei, Taiwan).

PMA, ATP, nigericin, PF-431396, 4′,6-diamidino-2-phenylindole (DAPI), and the anti-Flag M2 antibody were purchased from Sigma. R406, PF-562271, and Z-VAD-FMK were purchased from Selleckchem. Anti-Pyk2¸ anti-Syk, anti-p-Pyk2, anti-p-FAK, anti-p-Syk, and anti-GAPDH were purchased from Cell Signaling. Anti-FAK, anti-ASC, anti-caspase-1, and anti-IL-1β were purchased from Santa Cruz. Anti-Ly6G-PE and anti-CD11b-APC were purchased from BD Bioscience. MSU, PF-573228, anti-NLRP3, anti-mCherry, anti-F4/80-FITC, and Alexa Fluor 488–conjugated goat anti-rabbit IgG were purchased from InvivoGen, Tocris Bioscience, AdipoGen, Abcam, eBioscience, and Invitrogen, respectively. Plasmids encoding His-tagged wild-type and mutant (Y146F) ASC were generated by ligation of amplified DNA fragments to NdeI/XhoI-treated pET15b (Novagen, EMD Millipore, Darmstadt, Germany). The His-tagged mutant ASC (Y146F) was constructed using a QuikChange Site-Directed Mutagenesis kit (Stratagene) with forward primer 5′- GACGG ATGAG CAGTT CCAGG CAGTG CGGGC -3′ and reverse primer 5′- GCCCG CACTG CCTGG AACTG CTCAT CCGTC -3′. The mutant sequences are underlined. pENTER-Pyk2-Flag was purchased from ViGene Biosciences. The expression vectors for ASC-Flag and ASC were constructed using the pLKO_AS2 vector (RNAi Core, Taiwan), and that for Flag-NLRP3 was constructed using the pFLAG-CMV2 vector (Sigma).

Human TARDBP upstream and intronic genomic DNA were isolated from human induced pluripotent stem cell (hiPSC)-derived neural stem cells (201B7) using TRIzol reagent (Invitrogen) following the manufacturer’s instructions. The cloned genome and luciferase (Luc2) gene liberated from the Luc2/pGL4 vector (Promega) were subcloned into the pcDNA3.1 (−) vector (Invitrogen). Promoter fragment/Luc2 constructs were produced using the primers described in Table S3. The hnRNP K/pFLAG-CMV2 plasmid used for hnRNP K overexpression was a gift from Dr. Yano. For TDP-43-Venus overexpression, TDP-43-Venus/pcDNA3 and TARDBP upstream region-TDP-43-Venus/pcDNA3.1(−) were constructed using the former plasmid. For the promoter assay, TDP-43 (WT, G348C, A382T and F147/149L) were cloned into the pFLAG-CMV2 vector (Sigma). All primer sequences used for plasmid construction are described in the Supplemental Information (Tables S2, S3). PCR for the construction was conducted using PrimeSTAR MAX (Takara Bio) according to the manufacturer’s protocol.
For TDP-43 KD, double-stranded siRNA targeting TDP-43 was originally designed using siDirect software (Version 2.0, http://sidirect2.rnai.jp/). The target and negative control siRNA sequences are described in Table S1.

The E4orf6 (E434K) gene was subcloned from dl324-BstBI into the pFlag-CMV2 vector (Sigma-Aldrich, United States). Two PCR primers containing the HindIII and XbaI restriction sites were used to amplify the E4orf6 coding sequence from dl324-BstBI. The primers used for amplification are listed in Table S1. The resulting product was ligated with the HindIII, XbaI-digested pFlag-CMV2 vector.

Epitope-tagged CLC-1 constructs were generated by subcloning human CLC-1 cDNA into either the pcDNA3 vector (Invitrogen) (for Myc and HA tags)14 (link) or the pFlag-CMV2 vector (Sigma) (for Flag tag)18 (link). Other cDNA constructs employed in this study include pcDNA3.1-Myc mouse Aha1, pcDNA3-Myc human cullin 4A/4B (Addgene 19951/19922), pcDNA3.1-Myc mouse FKBP8, pcDNA3-HA rat HOP, pcDNA5-V5 human Hsc70 (Addgene 19514), pcDNA5-V5 human Hsp70 (Addgene 19510), pcDNA3-HA human Hsp90α (modified from an original clone kindly provided by Dr. Didier Picard, University of Geneva), and pcDNA3-HA human Hsp90β (Addgene 22847).