gRNAs were designed using the online tool CCTop-CRISPR/Cas9 as a target online predictor (Supplementary Table S3 ). We designed oligos for cloning gRNA targeting this site into a PEP-KO vector (Oligo1: 5′- ACCGNNNNNNNNNNNNNNNNNNNN-3′, Oligo2: 3′-CNNNNNNNNNNNNNNNNNNNNCAA-5′, N for gRNA sequence). Briefly, the two oligos were phosphorylated and annealed with T4 Ligation Buffer (Takara, Kyoto, Japan) and T4 PNK (Takara, Kyoto, Japan) according to the standard parameters. Annealed oligos were diluted 1:200 in nuclease-free water and ligated into the PEP-KO vector using T4 Ligation Buffer (Takara, Kyoto, Japan). After transfection of the vector into competent cells, 3–4 single colonies were picked into to 5 mL of Luria-Bertani (LB) broth containing carbenicillin. Plasmid DNA was isolated from amplified competent cells using a standard method and analyzed the plasmid DNA by Sanger sequencing. The plasmid was transfected into ATDC5 cells (500 ng PEP-KO, based on 6-well plate) following the standard infection protocol. After transfection for 48 h, select with puromycin (puro) and re-plated cells at a low density in a 10-cm dish (100 cells). Single colonies were expanded, and a portion of the cells was harvested, RT-qPCR, and western blotting analysis.
T4 pnk
Manufactured by Takara Bio
Sourced in Japan
T4 Polynucleotide Kinase (T4 PNK) is a widely used enzyme in molecular biology laboratories. Its core function is to catalyze the transfer of the terminal phosphate group from ATP to the 5' hydroxyl terminus of DNA, RNA, or oligonucleotides, thereby facilitating various DNA and RNA manipulation techniques.
Automatically generated - may contain errors
Lab products found in correlation
5 azacytidine 5 aza, by Merck Group (2 mentions)
T4 dna ligase, by New England Biolabs (2 mentions)
T4 ligation buffer, by Takara Bio (1 mentions)
Pspcas9 bb 2a gfp, by Addgene (1 mentions)
Agarose, by Beyotime (1 mentions)
Lambda exonuclease, by New England Biolabs (1 mentions)
M sssi, by New England Biolabs (1 mentions)
Hpaii restriction endonuclease, by New England Biolabs (1 mentions)
5 fluorouracil, by Merck Group (1 mentions)
Exonuclease 1, by New England Biolabs (1 mentions)
Rtaq dna polymerase, by Takara Bio (1 mentions)
Oligonucleotide, by Sangon (1 mentions)
Phi29 dna polymerase, by New England Biolabs (1 mentions)
Gel loading buffer 2, by Thermo Fisher Scientific (1 mentions)
Expresshyb, by Takara Bio (1 mentions)
Microspin g 25 column, by GE Healthcare (1 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using t4 pnk
1
CRISPR gRNA Plasmid Construction
2
CRISPR-Cas9 Editing of TGFBI R124H Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single gRNA targeting the R124H mutation site of the human TGFBI gene was designed using the CRIPSR design tool (publically available at http://crispr.mit.edu/ , http://www.e-crisp.org/E-CRISP/ ). To construct the CRISPR-Cas9 plasmid targeting the human TGFBI gene, the complementary oligonucleotides hTGFBI gRNA-F and hTGFBI gRNA-R were phosphorylated using T4PNK (TAKARA, Kusatsu, Japan), annealed, and cloned into pSpCas9 BB-2A-GFP (PX458, plasmid #48138; Addgene, Cambridge, MA, USA) via the BbsI restriction sites. To utilize HDR to edit the human TGFBI R124H mutation, a 100-nt ssODN (hTGFBI R124H HDR ssODN) was designed to target the R124H mutation site.
The oligonucleotide sequences were as follows:
hTGFBI gRNA-F: 5′-CACCACTCAGCTGTACACGGACCACA-3′,
hTGFBI gRNA-R: 5′-AAACTGTGGTCCGTGTACAGCTGAGT-3′,
and hTGFBI R124H HDR ssDNA: 5′-GAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGACCGTAC
The oligonucleotide sequences were as follows:
hTGFBI gRNA-F: 5′-CACCACTCAGCTGTACACGGACCACA-3′,
hTGFBI gRNA-R: 5′-AAACTGTGGTCCGTGTACAGCTGAGT-3′,
and hTGFBI R124H HDR ssDNA: 5′-GAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGAC
3
Oligonucleotide Synthesis and Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, oligonucleotides were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China) and HPLC-purified. All synthesized oligonucleotides are listed in Table S1 . Lambda exonuclease, T4 DNA ligase, exonuclease I, Phi29 DNA polymerase, HpaII restriction endonuclease, M.SssI were acquired from New England Biolabs (Beijing, China), and r Taq DNA Polymerase and T4 PNK were obtained from Takara Biotechnology (Dalian, China) Co., Ltd., and 5-Azacytidine (5-Aza) and 5-fluorouracil were purchased from Sigma–Aldrich. Agarose, 40% polyacrylamide (29:1), and nucleic acid dye Gel Red (10,000×) were purchased from Beyotime Biotechnology (Shanghai, China). SYBRTM Gold was obtained from Life TechnologiesTM (Eugene, OR, USA).
4
DNA Methylation Modification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the oligonucleotides used in this study were synthesized and HPLC-purified from Sangon Biotechnology Co., Ltd. (Shanghai, China), and all the sequences were shown in Table S1 . T4 DNA ligase、ExoI exonuclease、ExoIII exonuclease and M. SssI MTase were bought from New England Biolabs (Beijing, China). DNA endonuclease (GlaI) with 10 × SEBuffer Y (660 mM potassium acetate, 330 mM Tris-acetate, and 100 mM magnesium acetate, 10 mM DTT, pH 7.9) were bought from SibEnzyme Ltd. (Ak, Novosibirsk, Russia). T4 PNK were bought from Takara Bio. (Dalian, China). 5-Azacytidine (5-Aza) was bought from Sigma-Aldrich. The chemical reagents used in this study were analytical grade.
5
Generating Zebrafish lbx1b and lbx2 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the caudal fins of lbx1b TALENs mRNA-injected zebrafish. For sequencing, PCR products were amplified from the genomic DNA and phosphorylated by T4PNK (TAKARA BIO INC.), and then subcloned into EcoRV site of pBluescript II SK(+) vector. We identified F0 fishes carrying multiple mutations in the target site, and then generated and screened a F1 fish with a nonsense mutation by crossing the F0 and wild type fishes. lbx1b+/- and lbx2+/- mutant were generated by crossing F1 and wild type fishes. lbx1b-/- and lbx2-/- were further generated by intercrossing lbx1b+/- and lbx2+/-, respectively.
6
Northern Blot Analysis of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LNA/DNA probes (PAGE grade, fasmac, Table SX) were labelled with 32P-γ-ATP by . CC-BY-NC-ND 4.0 International license granted bioRxiv a license to display the preprint in perpetuity. It is made available under a
The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has this version posted March 6, 2020. ; https://doi.org/10.1101/2020.02.16.951954 doi: bioRxiv preprint means T4PNK (Takara), followed to filter by MicroSpin G-25 Columns (GE healthcare). 4 ug of small RNA purified by the mirVana miRNA Isolation kit (Thermo Fisher Scientific) was heated at 90 °C for 20 sec with gel loading buffer II (Thermo Fisher Scientific) and placed on ice, followed by running on a 15% TBE-Urea PAGE. RNA was transferred to a Hybond-N+ membrane (GE Healthcare) at 4mA/cm 2 for 45 min and fixed by UV-crosslinking. The membrane was dried and pre-hybridized at 37 °C for 30 min in ExpressHyb (Clontech). Hybridization was performed in ExpressHyb containing RI-labeled probe at 37 °C overnight with rotation. Subsequently, the membrane was washed twice in low stringency buffer (2X SSC, 0.05% SDS) at room temperature for 30 min and twice in high stringency buffer (0.5X SSC, 0.1% SDS) at room temperature for 40 min. Membranes were exposed to an autoradiography film.
The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has this version posted March 6, 2020. ; https://doi.org/10.1101/2020.02.16.951954 doi: bioRxiv preprint means T4PNK (Takara), followed to filter by MicroSpin G-25 Columns (GE healthcare). 4 ug of small RNA purified by the mirVana miRNA Isolation kit (Thermo Fisher Scientific) was heated at 90 °C for 20 sec with gel loading buffer II (Thermo Fisher Scientific) and placed on ice, followed by running on a 15% TBE-Urea PAGE. RNA was transferred to a Hybond-N+ membrane (GE Healthcare) at 4mA/cm 2 for 45 min and fixed by UV-crosslinking. The membrane was dried and pre-hybridized at 37 °C for 30 min in ExpressHyb (Clontech). Hybridization was performed in ExpressHyb containing RI-labeled probe at 37 °C overnight with rotation. Subsequently, the membrane was washed twice in low stringency buffer (2X SSC, 0.05% SDS) at room temperature for 30 min and twice in high stringency buffer (0.5X SSC, 0.1% SDS) at room temperature for 40 min. Membranes were exposed to an autoradiography film.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!