The largest database of trusted experimental protocols

16 protocols using plvx puro

1

Generation of CD24 knockdown cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human CD24 cDNA (CCDS75499.1) was cloned into pLVX-puro (Takara). shRNA oligonucleotides targeting CD24 or nontargeting control oligonucleotides were cloned into Tet-pLKO-puro (a gift from Dmitri Wiederschain, Addgene plasmid #21915) [54] (link) according to the published protocol (Addgene). Lenti-X 293T cells (Takara) were transfected using FuGENE 6 reagent (Promega) with pMD2.G and psPAX2 packaging plasmids (gifts from Didier Trono, Addgene #12259 and #12260, respectively), and pLVX-puro-CD24, empty pLVX-puro vector, Tet-pLKO-puro-shCD24 or Tet-pLKO-puro-shNTC. Lentiviral particles were purified from filtered supernatant using Lenti-X Concentrator (Takara), and the viral pellet was resuspended in fresh Neurocult medium for two 12-hr transductions on consecutive days. Transduced cells were selected with puromycin. Dox dosage was titrated, and the optimal dose of 100 ng/mL was used. shRNA sequences:
NameTarget sequence (sense)
shNTCCAACAAGATGAAGAGCACCAA
shCD24_3GCAGTCAACAGCCAGTCTCTT
shCD24_5CTTCTGCATCTCTACTCTTAA
+ Open protocol
+ Expand
2

Targeted Knockdown of USP51 via shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Targeting different sites of the USP51 gene (NM_201286.3), three short hairpin RNA (shRNA) sequences were synthesized (Table I) and double-strand annealed to form three shRNA constructs which were then inserted into the pLKO.1-puro vector (Addgene, Inc.) at AgelI/EcoRI restriction sites. The coding DNA sequence (CDS) region of USP51, full-length of 2,136 bp, as well as ZEB1, were respectively synthesized (cat. no. 10878; Genewiz, Inc.) and inserted into the EcoRI/BamHI restriction sites of the pLVX-Puro (Clontech Laboratories, Inc.) vector. After confirmation of DNA sequencing (Shanghai Meiji Biomedical Technology Co., Ltd.), Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.; according to the manufacturer's protocol) was used to transfect 3 µg pLKO.1-shUSP51, 4 µg pLVX-Puro-USP51 or 4 µg pLVX-Puro-ZEB1 into 2×105 293T cells/well in 6-well plates along with two viral packaging plasmids, psPAX2 and pMD2G (Addgene, Inc.). The virus particles in the medium were collected by ultracentrifugation (8,000 × g; 4°C; 2 h) following 48 h of transfection at 37°C.
+ Open protocol
+ Expand
3

Culturing and Transducing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
E0771 (ATCC) were cultured in RPMI supplemented with 10% FBS. 4T1 cells (ATCC), 4T1-NY-ESO-1 (a kind gift from Uzi Gileadi, Oxford), 4T1 expressing GFP (4T1-GFP) and murine endothelial cells (sEnd-1) (13 (link)) were cultured in DMEM supplemented with 10% FBS. Cell lines were authenticated using mouse STR profiling (ATCC) and tested for Mycoplasma contamination (MycoAlert™, Lonza). All media components were purchased from ThermoFisher. Mouse codon optimised Eltd1 (mcoEltd1) was cloned into pLVX-Puro (Addgene) and the vector alone was used as a control. Virus was produced in 293T cells and the viral supernatant was used to make stable cell lines after selection in 1μg/ml puromycin (ThermoFisher).
+ Open protocol
+ Expand
4

Constructing OPN Expressing and Silencing Lentiviral Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
To construct OPN expressing lentiviral vector, the OPN cDNA sequences (NCBI number: NM_000582) was amplified by PCR and cloned into the plvx-puro vector with flanking XhoI and BamHI restriction sites following the Lentivector User Manual (Addgene, Cambridge, Mass., USA). To construct OPN silencing lentiviral vector, oligonucleotides coding for shOPN-forward: 5'-GATCCCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTTG-3', and shOPN-reverse: 5'-AATTCAAAAACTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGG-3' were synthesized by Invitrogen Biotech. (Shanghai, China) and cloned into the vector pGreenPuro (Addgene). The constructed vectors were named OPN-plvxpuro and shOPN-pGreenpuro, respectively. Both constructs were confirmed by XhoI/BamHI digestion and sequencing. The plvx-puro vector was used as blank expression control. The lentiviral vector containing the non-silencing sequence (shNC-pGreenpuro) were used as blank interference control.
+ Open protocol
+ Expand
5

Lentiviral Modulation of TRIM46 and PHLPP2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNA (shRNA) oligos targeting TRIM46 (shTRIM46-1, 5′-GGTGAGGATATGCAGACCT-3′; shTRIM46-2, 5′-GATATGCAGACCTTCACTT-3′) were ligated into pLKO.1 (Addgene, Watertown, MA). Wild type human TRIM46 (TRIM46 WT), RING mutant human TRIM46 (TRIM46 WT) [20 (link)], and PHLPP2 was synthesized by Genwiz (Suzhou, China) and inserted into pLVX-puro (Addgene, Watertown, MA). Virus of shTRIM46, control shRNA (shNC), pLVX-TRIM46 (oeTRIM46), pLVX-PHLPP2 (oePHLPP2), or pLVX-puro (Vector) was produced in 293T cells.
+ Open protocol
+ Expand
6

Construction of GGCT/MRPL9 Expression Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the construction of the expression plasmid for GGCT/MRPL9, the GGCT/MRPL9DE CDS sequence was amplified from human cDNA and ligated into the pLVX-puro (Addgene, Watertown, MA, USA) vector. The procedure followed the instructions for the cloning kit and EcoRI restriction endonuclease sites were used (10911ES20, Yeasen, Shanghai, China). The plasmid of shGGCT/shMRPL9 was synthesized in Tsingke Biotechnology Co., Ltd. (Tsingke Biotechnology, Beijing, China). The PCR amplification primers and sh-RNA sequences mentioned above are provided in Supplementary Table S1. For lentivirus packaging, PEI (40820ES04, Yeasen, Shanghai, China). was used to transfect the target plasmid, pCMV-VSV-G (Beyotime, Shanghai, China) and pCAG-dR8.9 (Beyotime, Shanghai, China) in 293T cells (according to the ratio of target plasmid: pCMV-VSV-G: pCAG-dR8.9 = 4:3:1). The medium was replaced with fresh medium 6 h after transfection, and the virus stock solution was collected 48 h after transfection. For stably transfected cell lines, PTC cells were infected with LV-GGCT, LV-MRPL9, LV-sh-GGCT, LV-sh-MRPL9, LV-pLVX, LV-pLKO.1, then cells were treated with 1 ug/mL puromycin (Meilunbio, Dalian, China).
+ Open protocol
+ Expand
7

Plasmid Construction for Viral Protein Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
FLAG-HA-pcDNA3.1 (#52535) was purchased from Addgene and renamed pcDNA here. Based on this, we constructed plasmids expressing MOV10 and IKKε with Flag-HA tags. The ICP0-WT plasmid (pRS-1) and ICP0-M138 plasmids were previously described [44 (link),65 (link)]. To construct ICP0no3’UTR plasmid, the sequence between MluI and stop codon of pRS-1 was amplified and inserted between MluI and HindIII sites of pRS-1. As for ICP0nointron plasmid, ICP0 CDS fragment was amplified and then inserted between NcoI and MluI sites of pRS-1. To construct plasmids expressing truncated MOV10 mutants, we amplified the truncated Mov10 gene sequences by PCR and cloned them into the FLAG-HA-pcDNA3.1 vector using the Site-Directed Mutagenesis kit (#E0552S) purchased from New England Biolabs. Human MOV10 expressing sequences were amplified and inserted between the BamHI and XbaI restriction sites of pLVX-puro (Addgene) plasmid to construct pLVX-puroMOV10 plasmid for lentivirus production. Plasmids expressing MOV10 N- terminus (amino acids 1–495) and MOV10 C-terminus (amino acids 496–1003) were generously provided by Professor Zhiwei Wu (Nanjing University) [49 (link)]. Renilla luciferase plasmid and IFN-β promoter reporter plasmid were kindly provided by Chunfu Zheng at Fujian Medical University. The sequences of all primers used are listed in S2 Table.
+ Open protocol
+ Expand
8

Lentiviral Transduction of Nrf2 in Hematopoietic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant lentiviruses were amplified by transfecting HEK 293T cells at 75% confluence with 6 µg pMD2.G and 6 µg psPAX2 packaging plasmids (the 2nd generation lentiviral packaging plasmid; Addgene, Inc.) and 6 µg lentivirus-based Nrf2 expression plasmid (pLVX-puro; Addgene, Inc.) or 6 µg lentiviral-based short hairpin (sh)RNAs (pLKO.1-puro; Addgene, Inc.) specific for green fluorescent protein (GFP, CAAATCACAGAATCGTCGTAT; negative control) or Nrf2 (#1, GCTCCTACTGTGATGTGAAAT; 2#, GGAGTGTCAGTATGTTGAA) using Lipofectamine® 2000 (cat. no. 11668; Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C. Viruses were collected at 72 h after transfection. K562 or HL-60 cells at 40% confluence were infected with a recombinant lentivirus in the presence of 10 µg/ml polybrene, followed by 12 h incubation at 37°C with 5% CO2. After 36 h of infection, cells were treated with 2 µg/ml puromycin for 24 h. The viable cells were used to further experiments. The infection efficiency was ~85%.
+ Open protocol
+ Expand
9

Knockdown and Overexpression of FLOT1 in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three small hairpin RNAs (shRNA1–shRNA3) targeting FLOT1 were designed, with shRNA sequences as follows: 5′‐GGA AGA CGG AGG CTG AGA TTG‐3′ for shRNA1; 5’‐GCA TCA GTG TGG TTA GCT ACA‐3′ for shRNA2; 5’‐GCT GGG ATC CGG GAA GCT AAA‐3′ for shRNA3; and 5′‐GTT CTC CGA ACG TGT CAC GT‐3′ for scramble shRNA. shRNAs and scramble shRNA were cloned into pLKO.1 (Addgene, Cambridge, MA, USA). Full‐length FLOT1 was inserted into pLVX‐Puro (Addgene). For lentiviral particle preparation, targeted viral plasmids, psPAX2 and pMD2G, were employed to transfect 293 T cells with Lipofectamine 2000 (Invitrogen, Shanghai, China) according to the manufacturer's instructions. The A549 cell line was infected with shRNAs or overexpressed viral supernatants, and FLOT1 expression was evaluated by quantitative PCR (qPCR) and Western blotting. FLOT1‐knockdown (shFLOT1) and overexpression (OEFLOT1) of stable cell lines was then generated by puromycin (Sigma‐Aldrich, St Louis, MO, USA) selection and used for further experiments.
+ Open protocol
+ Expand
10

Lentiviral Knockdown of eIF4A1 and c-MYC

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus pLVX-Puro (Addgene) was obtained from DesignGene Biotechnology (Shanghai, China) and used to clone shRNA sequences. The vectors were designated Lv-eIF4A1 (eIF4A1-1, 5′-CACACTGGACTAGTGGATCCCGCCACCATGTCTGCGAGCCAGGATTCCC-3′; eIF4A1-2, 5′-AGTCACTTAAGCTTGGTACGATGAGGTCAGCAACATTGAGG-3′), Lv-sh-c-MYC (c-MYC-1, 5′-GCTTCACCAACAGGAACTATG-3′; c-MYC-2, 5′-GCTTGTACCTGCAGGATCTGA-3′; c-MYC-3, 5’-GGAAACGACGAGAACAGTTGA-3′) and Lv-sh-control (empty vector). The lentivirus plasmid and packaging plasmids were transfected into pancreatic cancer cells with transfection reagent (Lipofectamine®3000, Thermo Fisher Scientific) in OPTI-MEM media (Invitrogen, MA, USA). Lentiviral infection of the target cells was performed in cell culture medium containing 5 μg/ml polybrene (Sigma H9268), and infected cells were selected with 2.5 μg/ml puromycin for follow-up experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!