shNTC | CAACAAGATGAAGAGCACCAA |
shCD24_3 | GCAGTCAACAGCCAGTCTCTT |
shCD24_5 | CTTCTGCATCTCTACTCTTAA |
Plvx puro
The PLVX-puro plasmid is a lentiviral expression vector that can be used to generate stable cell lines through puromycin selection. It contains a puromycin resistance gene for selection purposes.
Lab products found in correlation
16 protocols using plvx puro
Generation of CD24 knockdown cell lines
Targeted Knockdown of USP51 via shRNA
Culturing and Transducing Cell Lines
Constructing OPN Expressing and Silencing Lentiviral Vectors
Lentiviral Modulation of TRIM46 and PHLPP2
Construction of GGCT/MRPL9 Expression Plasmid
Plasmid Construction for Viral Protein Studies
Lentiviral Transduction of Nrf2 in Hematopoietic Cells
Knockdown and Overexpression of FLOT1 in A549 Cells
Lentiviral Knockdown of eIF4A1 and c-MYC
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!