Brilliant 2 sybr green kit

Four days after siRNA transfection or 24 hour after treatment with 1 µg/ml tunicamycin, RNA was extracted using the RNeasy kit (Qiagen) followed by cDNA synthesis using the qPCRBIO cDNA synthesis kit (PCR Biosystems). PCR was performed with the Brilliant II SYBR green kit (Agilent Technologies) using the following primers. GAPDH-F: CCGCATCTTCTTTTGCGTCGC, GAPDH-R: AAATGAGCCCCAGCCTTCTCCATG. ATF4 F: TGACCTGGAAACCATGCCAG, ATF4 R: AATGATCTGGAGTGGAGGAC, CHOP F: GGAGCATCAGTCCCCCACTT, CHOP R: TGTGGGATTGAGGGTCACATC, ERDJ4 F: AAAATAAGAGCCCGGATGCT, ERDJ4 R: CGCTTCTTGGATCCAGTGTT. Ct values were converted into relative copy number and normalized to the GAPDH control.

Total RNA from mammalian cells was extracted using peqGOLD total RNA kit (Peqlab) according to the manufacturer’s directions. RNA was converted to cDNA using Quantitect Reverse Transcription Kit (Qiagen). For quantitative PCR, Brilliant II Sybr green kit (Stratagene/Agilent), including specific MX3005P 96-well semi-skirted plates, was used to analyse samples on the MX3005P qPCR platform (Stratagene/Agilent). Actin was used as a normalising gene in all experiments. The following primers were used for RT-qPCR: actin, F: 5′-CTGGGAGTGGGTGGAGGC-3′, R: 5′-TCAACTGGTCTCAAGTCAGTG-3′. p100, F: 5′-AGCCTGGTAGACACGTACCG-3′, R: 5′-CCGTACGCACTGTCTTCCTT-3′. IL-8, F: 5′-CCAGGAAGAAACCACCGGA-3′, R: 5′-GAAATCAGGAAGGCTGCCAAG-3′. XIAP, F: 5′-CTGTTAAAAGTCATCTTCTCTTGAAA-3′, R: 5′-GACCCTCCCCTTGGACC-3′. HIF-1α, F: 5′-CATAAAGTCTGCAACATGGAAGGT-3′, R: 5′-ATTTGATGGGTGAGGAATGGGTT-3′. A20, F: 5′-ACAGCTTTCCGCATATTGCT-3′, R: 5′-TTGACCAGGACTTGGGACTT-3′. IAP1, F: 5′-AACTCTTGGCCTTTCATTCG-3′, R: 5′-TGTTGTGATGGTGGCTTGAG-3′. IκB-α, F: 5′-AAAGCCAGGTCTCCCTTCAC-3′, R: 5′-CAGCAGCTCACCGAGGAC-3′.
Primer sets for CYLD and DDX3 were obtained from Qiagen.

Total RNA from mammalian cells was extracted using peqGOLD total RNA kit (Peqlab), according to the manufacturer's directions. RNA was converted to cDNA using Quantitect Reverse Transcription Kit (Qiagen). For QPCR, Brilliant II SYBR green kit (Stratagene/Agilent), including specific MX3005P 96 well semi-skirted plates, were used to analyse samples on the Mx3005P QPCR platform (Stratagene/Agilent). Actin was used as a normalizing gene in all experiments. The Primers used for RT–QPCR are shown in Table 2.

RNA from the HeLa cells was extracted using a peqGOLD total RNA kit (Peqlab, Bishop’s Waltham, UK), from the HEK293 cells—using a Direct-Zol RNA MiniPrep kit (Zymo Research, Irvine, USA) according to the manufacturers’ protocols. RNA was reverse-transcribed using a Quantitect Reverse Transcription kit (Qiagen, Manchester, UK). Real-time PCR was performed using the Brilliant II SYBR Green kit (Stratagene/Agilent, Stockport, UK) on an Mx3005P qPCR machine (Stratagene/Agilent, Stockport, UK). Levels of mRNA were calculated based on averaged Ct values and normalized to β-actin mRNA levels. The following primers were used for qPCR: HIF-1α forward CATAAAGTCTGCAACATGGAAGGT, HIF-1α reverse ATTTGATGGGTGAGGAATGGGTT, HIF-1β forward CAAGCCCCTTGAGAAGTCAG, HIF-1β reverse GAGGGGCTAGGCCACTATTC, β-actin forward CCCAGAGCAAGAGG, β-actin reverse GTCCAGACGCAGGATG, HK2 forward AGCCCTTTCTCCATCTCCTT, HK2 reverse AACCATGACCAAGTGCAGAA, PHD2 forward GAAAGCCATGGTTGCTTGTT, PHD2 reverse TGTCCTTCTGGAAAAATTCG, PHD3 forward CTTGGCATCCCAATTCTTGT, PHD3 reverse ATCGACAGGCTGGTCCTCTA, GLUT1 forward TCAAAGGACTTGCCCAGTTT, GLUT1 reverse GATTGGCTCCTTCTCTGTGG, VEGF forward AGCTGCGCTGATAGACATCC, VEGF reverse CTACCTCCACCATGCCAAGT, BNIP3 forward GCCCACCTCGCTCGCAGACAC, BNIP3 reverse CAATCCGATGGCCAGCAAATGAGA.

Total RNA, from non-irradiated or 10 Gy irradiated macrophages, was extracted using TriPure Isolation Reagent (Roche), according to manufacturer’s instructions. RNA was converted to cDNA using 150 U of SuperScript™ II Reverse Transcriptase, 1× first strand buffer, 10 mM DTT 0.1 M (Invitrogen), 0.5 mM dNTPs 10 mM (Bioron), 8U of rRNasin (Promega) and RNase/DNase free water (Gibco). To evaluate mRNA expression levels of pro- and anti-inflammatory gene markers, quantitative PCR using Brilliant II Sybr green kit (Stratagene/Agilent Technologies) and specific MX3005P 96-well semi-skirted plates, were performed. Samples were analysed on the MX3005P qPCR platform (Stratagene/Agilent). The following primers, from Invitrogen, were used for RT-qPCR: CXCL8, F: 5′-CCAGGAAGAAACCACCGGA-3′, R: 5′-GAAATCAGGAAGGCTGCCAAG-3′; IL1B, F: 5′-GGCAGGGAACCAGCATC-3′, R: 5′-CCGACCACCACTACAGCAA-3′; TNF F: 5′- GGCTGGAGCTGAGAGATA-3′, R: 5′-CAGCCTTGGCCCTTGAAGA-3′. Primer sets for ACTB (used as a normalizing gene), CXCL12 and CCL2 were obtained from Qiagen, while probes for CD80, CCR7, IL6, CD163, MRC1 and VCAN were from Applied Biosystems.