Log In Sign up
The largest database of trusted experimental protocols

Alightcycler 480

Manufactured by Roche
Visit Supplier
Sourced in Brazil

The LightCycler 480 is a real-time PCR instrument designed for high-throughput quantitative and qualitative nucleic acid analysis. It features a 96-well microplate format and can perform up to 45 PCR cycles per run.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) Rnaeasy micro kit, by Qiagen (2 mentions) Iscript reverse transcriptase, by Bio-Rad (2 mentions) Itaq universal sybr green, by Bio-Rad (2 mentions) Luna universal one step rt qpcr kit, by New England Biolabs (1 mentions) Viral toxglo assay kit, by Promega (1 mentions) Luna cell ready lysis module, by New England Biolabs (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Chamq universal sybr qpcr master mix, by Vazyme (1 mentions) Hiscript 3 rt supermix, by Vazyme (1 mentions) Qscript cdna supermix, by Quanta Biosciences (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Perfecta sybr green fastmix, by Quanta Biosciences (1 mentions) Pcr master mix, by Roche (1 mentions) Taqman reverse transcription reagents kit, by Thermo Fisher Scientific (1 mentions) Verso cdna kit, by Thermo Fisher Scientific (1 mentions) Anchored oligo dt primers, by Thermo Fisher Scientific (1 mentions) 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions) Sybr premix ex taq 2 perfect real time, by Takara Bio (1 mentions)

10 protocols using alightcycler 480

1

Genotyping and qPCR Protocols for Mouse and Human Vitamin C Transporters

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR Genotyping primers:

Gulo: 5′-CCCAGTGACTAAGGATAAGC-3′, 5′-CGCGCCTTAATTAAGGATCC-3′, 5′-GTCGTGACAGAATGTCTTGC-3′. Wild type band= 343bp, knockout band= 230bp.

Slc23a2−: 5′-GGCAGTGTTGGTCCTTCTGT-3′, 5′-CTGGCTATCCTCGTGTCCTG-3′ 5′-CTTAAACCATGGGGCTACCA-3′, 5′-AGACTGCCTTGGGAAAAGCG-3′, wild type band= 140bp, knockout band= 180bp

Tet2fl and Flt3ITD genotyping were as previously described 27 (link),49 (link).
For qPCR, cells were sorted into RLT buffer (Qiagen RNAeasy Micro kit) and RNA was purified according to the manufacturer’s instructions. cDNA was made with iScript reverse transcriptase (BioRad) and quantitative PCR was performed with iTaq Universal SYBR Green (BioRad) and a LightCycler 480 (Roche Applied Science). The signal from each sample was normalized to β-actin. qPCR primers:

Mouse Slc23a2: 5′-GGACAACACCATCCCAGGTA-3′, 5′-CCTTTGCTCACACCCTTCTT-3′.

Mouse Slc23a1: 5′-GAAGCCACCTCAATGAAAGG-3′, 5′-GCTGAGATCTCCAACTCAGGTC-3′.

Mouse β-actin: 5′-CACTGTCGAGTCGCGTCC-3′, 5′-TCATCCATGGCGAACTGGTG-3′

Human SLC23A2: 5′-CTGCAGCCAGCTAGGTCTTG-3′, 5′-AAGCTAGGAGCCCAGGATCA-3′

Human SLC23A1: 5′-TCCTCCTCCTTGGCCTTTGT-3′, 5′-CCCTGGTGGTTTCATGCTGT-3′

Human β-ACTIN: 5′-ATTGGCAATGAGCGGTTC-3′, 5′-CGTGGATGCCACAGGACT-3′

Agathocleous M., Meacham C.E., Burgess R.J., Piskounova E., Zhao Z., Crane G.M., Cowin B.L., Bruner E., Murphy M.M., Chen W., Spangrude G.J., Hu Z., DeBerardinis R.J, & Morrison S.J. (2017). Ascorbate regulates haematopoietic stem cell function and leukaemogenesis. Nature, 549(7673), 476-481.
+ Open protocol
+ Expand
2

SARS-CoV-2 Infection Assay with Viral RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Six hours after siRNA transfection, the medium was removed, cells were rinsed with PBS, then incubated in fresh DMEM (for Vero E6) or RPMI (for A549-hACE2) medium. Onehour later, SARS-CoV-2 (strain #2020-A0093534 isolated by CPP Île de France III and provided by Collection resource CRB of the Montpellier hospital) was inoculated at MOI = 0.01. Cytopathic effect was assessed using the Viral ToxGlo Assay kit (Promega) 72 h after infection. For viral RNA quantification: cells were rinsed with PBS, lysed with the Luna Cell Ready Lysis Module (New England BioLabs): in a96 well plate, cells were lysed in 40 μ Llysis buffer per well (10 min incubation at 37°C, then 5 μ LStop mix was added to each well), then lysates were transferred to anew plate and frozen at −80°C. 1 μ Llysate was used as atemplate for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on aLight Cycler 480 (Roche). Viral RNA (mRNA for gene E) was amplified with primers ACAGGTACGTTAATAGTTAATAGCGT and ATATTGCAGCAGTACGCACACA; for normalization, cellular GAPDH mRNA was amplified with primers GCTCACTGGCATGGCCTTCCGTG and TGGAGGAGTGGGTGTCGCTGTTG.
As apositive antiviral control, Remdesivir was added to the cell medium at 10 μ Mafter viral infection.
Houbron É., Mockly S., Rafasse S., Gros N., Muriaux D, & Seitz H. (2023). Biochemistry-informed design selects potent siRNAs against SARS-CoV-2. RNA Biology, 20(1), 272-280.
+ Open protocol
+ Expand
3

Genotyping and qPCR Protocols for Mouse and Human Vitamin C Transporters

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR Genotyping primers:

Gulo: 5′-CCCAGTGACTAAGGATAAGC-3′, 5′-CGCGCCTTAATTAAGGATCC-3′, 5′-GTCGTGACAGAATGTCTTGC-3′. Wild type band= 343bp, knockout band= 230bp.

Slc23a2−: 5′-GGCAGTGTTGGTCCTTCTGT-3′, 5′-CTGGCTATCCTCGTGTCCTG-3′ 5′-CTTAAACCATGGGGCTACCA-3′, 5′-AGACTGCCTTGGGAAAAGCG-3′, wild type band= 140bp, knockout band= 180bp

Tet2fl and Flt3ITD genotyping were as previously described 27 (link),49 (link).
For qPCR, cells were sorted into RLT buffer (Qiagen RNAeasy Micro kit) and RNA was purified according to the manufacturer’s instructions. cDNA was made with iScript reverse transcriptase (BioRad) and quantitative PCR was performed with iTaq Universal SYBR Green (BioRad) and a LightCycler 480 (Roche Applied Science). The signal from each sample was normalized to β-actin. qPCR primers:

Mouse Slc23a2: 5′-GGACAACACCATCCCAGGTA-3′, 5′-CCTTTGCTCACACCCTTCTT-3′.

Mouse Slc23a1: 5′-GAAGCCACCTCAATGAAAGG-3′, 5′-GCTGAGATCTCCAACTCAGGTC-3′.

Mouse β-actin: 5′-CACTGTCGAGTCGCGTCC-3′, 5′-TCATCCATGGCGAACTGGTG-3′

Human SLC23A2: 5′-CTGCAGCCAGCTAGGTCTTG-3′, 5′-AAGCTAGGAGCCCAGGATCA-3′

Human SLC23A1: 5′-TCCTCCTCCTTGGCCTTTGT-3′, 5′-CCCTGGTGGTTTCATGCTGT-3′

Human β-ACTIN: 5′-ATTGGCAATGAGCGGTTC-3′, 5′-CGTGGATGCCACAGGACT-3′

Agathocleous M., Meacham C.E., Burgess R.J., Piskounova E., Zhao Z., Crane G.M., Cowin B.L., Bruner E., Murphy M.M., Chen W., Spangrude G.J., Hu Z., DeBerardinis R.J, & Morrison S.J. (2017). Ascorbate regulates haematopoietic stem cell function and leukaemogenesis. Nature, 549(7673), 476-481.
+ Open protocol
+ Expand
4

Quantitative RT-qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). cDNA was synthesized using total RNA and HiScript III RT SuperMix (Vazyme Biotech Co., Ltd.) at 37°C for 15 h and then 85°C for 5 sec. ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.) and a Light Cycler 480 (Roche Diagnostics GmbH) were employed to amplify cDNA. The initial denaturation condition was 95°C for 10 sec. The thermocycling (40 cycles) conditions were as follows: 95°C for 10 sec and 60°C for 30 sec. mRNA levels were quantified using the 2−ΔΔCq method and normalized to the internal reference gene GAPDH (51 (link)). The specific primers are listed in Table SI.
Lin X., Yang Y., Huang Y., Li E., Zhuang X., Zhang Z., Xu R., Yu X, & Deng F. (2024). Mettl3‑mediated m6A RNA methylation regulates osteolysis induced by titanium particles. Molecular Medicine Reports, 29(3), 36.
+ Open protocol
+ Expand
5

Quantitative gene expression analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA isolated using TRIzol (Invitrogen) from pools of 15–20 dissected livers was reverse-transcribed using qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD). qPCR using A Light Cycler 480 (Roche) with PerfeCTa SYBRGreen FastMix (Quanta Biosciences) was used as previously described [11] (link). Values for target gene were normalized to reference gene rpp0, and dCts calculated using the comparative threshold method (dCt  = 2−(Ct, gene – Ct, rpp0)). Primer sequences are listed in Table S1.
Howarth D.L., Lindtner C., Vacaru A.M., Sachidanandam R., Tsedensodnom O., Vasilkova T., Buettner C, & Sadler K.C. (2014). Activating Transcription Factor 6 Is Necessary and Sufficient for Alcoholic Fatty Liver Disease in Zebrafish. PLoS Genetics, 10(5), e1004335.
+ Open protocol
+ Expand
6

Quantifying Gene Expression in Mouse and Human Intestinal Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the mouse small intestinal tissue samples and human CRC samples obtained in the United Kingdom (Wales cohorts 1 and 2), total RNA was used to synthesize first strand cDNA using a VersoTM cDNA Kit (Thermo Scientific) and anchored oligo-dT primers (Thermo Scientific) according to the manufacturer’s instructions. Single-stranded cDNA samples were amplified in a Polymerase chain reaction (PCR) using sequence-specific primers (Eurogentec) and probes from the Universal Probe Library (Roche) that were designed using the Universal ProbeLibrary Assay Design Centre, using PCR Master mix (Roche) and a light cycler 480 (Roche) (see Supplementary Table 2 for primers and probes used).
For the human CRC samples recruited in Brazil, RNA was extracted using the RNeasy® Mini Kit (Qiagen, Hilden, Germany). cDNA was produced using TaqMan® Reverse Transcription Reagents kit (Applied Biosystems, Carlsbad, CA, United States) according to the manufacturer’s protocol. Quantitative PCR reactions were performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, United States) (see Supplementary Table 3 for expression assay specifications).
Queiroz C.J., Song F., Reed K.R., Al-Khafaji N., Clarke A.R., Vimalachandran D., Miyajima F., Pritchard D.M, & Jenkins J.R. (2020). NAP1L1: A Novel Human Colorectal Cancer Biomarker Derived From Animal Models of Apc Inactivation. Frontiers in Oncology, 10, 1565.
+ Open protocol
+ Expand
7

RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified with a QIAshredder homogenizer and an RNeasy Mini Kit (QIAGEN Japan, Tokyo, Japan) according to the manufacturer’s instructions. cDNA was synthesized with a PrimeScript II 1st strand cDNA
Synthesis kit (Takara Bio Inc., Kusatsu, Shiga, Japan). The expression levels were monitored using SYBR Premix Ex Taq II (Perfect Real Time; Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions.
The cDNA mixture (250 ng) was added to 20 µl reaction mixture. The primers were as follows: GAPDH (tctgctgatgcccccatgttcg and tgggtggcagtgatggcatgga), TNF-α (ctgtagcccacgtcgtagc and tgagatccatgccgttg), IFN-γ
(tggaggaactggcaaaaggatggtg and cgctggacctgtgggttgttgacct), IL-12p40 (tctgctgatgcccccatgttcg and tgggtggcagtgatggcatgga), and IL-4 (acgccatgcacggagatggatg and ccaggcatcgaaaagcccgaaa). Reactions were performed using a
LightCycler 480 (Roche Diagnostics, Mannheim, Germany). Samples were quantified by comparison with a standard curve generated by cDNA templates using the respective primers. The value for the target gene was divided by
the value for the GAPDH gene, and relative gene expressions were normalized by the value for the control.
ASHIGAI H., KOMANO Y., WANG G., KAWACHI Y., SUNAGA K., YAMAMOTO R., TAKATA R., MIYAKE M, & YANAI T. (2017). Effect of administrating polysaccharide from black currant (Ribes nigrum L.) on atopic dermatitis in NC/Nga mice. Bioscience of Microbiota, Food and Health, 37(1), 19-24.
+ Open protocol
+ Expand
8

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
To confirm the observed ELISA results at mRNA level, a qPCR experiment was performed.
After incubation of the BV-2 cells with PapRIV or controls, cells were lysed in RLT buffer (Qiagen, Hilden, Germany) supplemented with 1% β-mercaptoethanol. The lysate was stored at -80°C until RNA extraction. RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany). DNAse steps were included in the protocol to remove possible DNA contamination.
RNA purity and concentration were assessed using spectrophotometry (NanoDrop), while RNA quality was evaluated using capillary electrophoresis (Fragment Analyzer). After extraction, the RNA was immediately converted to cDNA which was stored at -20°C until qPCR analysis.
Ppia and Rer were chosen as suitable control genes based on the GeNorm and Normfinder algorithms [52, 53] . Used primers are given in Table 1. qPCR cycling was performed using a
LightCycler 480 (Roche), with Cq values being calculated using the second derivative threshold method.
Janssens Y., Debunne N., Spiegeleer A.D., Wynendaele E., Planas M., Feliu L., Quarta A., Claes C., Dam D.V., Deyn P.P.D., Ponsaerts P., Blurton‐Jones M., & Spiegeleer B.D. (2020). PapRIV, a BV-2 microglial cell activating quorum sensing peptide.
+ Open protocol
+ Expand
9

Quantitative gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
First strand cDNA synthesis was performed using 1 μg total RNA with oligo-dT primer using Transcriptor High Fidelity cDNA Synthesis Kit (Roche), following manufacturer's instructions. The cDNA was used as template for amplification by qPCR using genespecific primers (listed on Suppl. Table S1). Cork oak Elongation factor 1 (LOC112038967) was used as internal control. Real Time qPCR was done in a
Lightcycler 480 (Roche), using Lightcycler 480 Master I Mix (Roche). Target transcript abundance was calculated according to Pfaffl (2001) .
Leal A.R., Sapeta H., Beeckman T., Barros P.M, & Oliveira M.M. (2022). Spatiotemporal development of suberized barriers in cork oak taproots. Tree physiology, 42(6).
+ Open protocol
+ Expand
10

Quantitative RT-PCR for sXBP1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted with TriPure Isolation Reagent (Roche) according to the manufacturer's protocol. After quantification by spectrophotometer Nanodrop 1000 (Thermo scientific), 500 ng of RNA were reverse-transcribed by using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific). Obtained cDNA was submitted to qRT-PCR on a
LightCycler 480 (Roche Applied Science). Relative gene expression was calculated using the 2delta delta C method with HPRT1 as housekeeping gene [21] (link). Results are representative from three independent experiments quantified in triplicate. The following primers were used:
HPRT1-Fw: 5′-TGACACTGGCAAAACAATGCA-3′; HPRT1-Rv: 5′-GCTTGCGACCTTGACCATCT-3′, sXBP1-Fw: 5′-CTGAGTCCGCAGCAGGTG-3' ; sXBP1-Rv: 5′-ACTGGGTCCAAGTTGTCCAG-3'.
Gianfrancesco M.A., Dehairs J., L'homme L., Herinckx G., Esser N., Jansen O., Habraken Y., Lassence C., Swinnen J.V., Rider M.H., Piette J., Paquot N, & Legrand-Poels S. (2019). Saturated fatty acids induce NLRP3 activation in human macrophages through K+ efflux resulting from phospholipid saturation and Na, K-ATPase disruption. Biochimica et biophysica acta. Molecular and cell biology of lipids, 1864(7).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!