Cells (1.5 3 106) were subjected to electroporation using Neonâ Transfection System 100 mL Kit (Thermo Fisher Scientific). To maximize the efficiency, the Neon 24 optimization protocol was applied according to the manufacturer’s instruction which varied in pulse voltage, pulse width and the number of pulses. Macrophages, differentiated with M-CSF for 6 days, were harvested using PBS plus 1 mM EDTA and the cell pellet was resuspended in 1 mL of PBS. 20 mM of human non-targeting siRNA (Thermo Fisher Scientific; D-001810-01-05) and 20 mM of ALOX15 Trilencer-27 Human siRNA (OriGene, SR300171) was resuspended in the Resuspension Buffer T (Thermo Fisher Scientific) and added to the cells before electroporation. The electroporated cells were transferred immediately to a 12-well containing 1 mL of the corresponding growth medium plus 20 ng/ml IL-4 (Peprotech) and then incubated for another 48 h in a 5% CO2 incubator.
Resuspension buffer t
Manufactured by Thermo Fisher Scientific
Resuspension Buffer T is a buffer solution designed for the resuspension of biomolecules, such as proteins or nucleic acids. It is formulated to maintain the stability and functionality of the biomolecules during the resuspension process.
Automatically generated - may contain errors
Lab products found in correlation
Interleukin 4 (il 4), by Thermo Fisher Scientific (2 mentions)
Human non targeting sirna, by Thermo Fisher Scientific (2 mentions)
Neon transfection system 100 ml kit, by Thermo Fisher Scientific (2 mentions)
Alox15 trilencer 27 human sirna, by OriGene (2 mentions)
Hpy188iii, by New England Biolabs (1 mentions)
Mpk1025, by Thermo Fisher Scientific (1 mentions)
3 protocols using resuspension buffer t
1
siRNA Transfection of Macrophages
2
Genetic Engineering of iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To genetically engineer iPSCs, cells were dissociated into single cells and 250 000 cells were transfected with 1 µg Cas9 mRNA and 1 µg guide RNA targeting exon 3 of MCM10 (Synthego Corporation, 5′GAAGAAAATAACTTCTTGACG) in Resuspension Buffer T (ThermoFisher) by electroporation with the Neon Transfection system (1100 V, 20 ms, 1 pulse, 10 µl tip, ThermoFisher MPK1025). Cells were grown with 10 µm ROCKi for 2 days before resuming normal culturing conditions. Single clones were isolated by plating transfected cells at low density and allowing colonies to form. Colonies were then transferred to separate wells by scraping. To assess targeting, primers to introns 2 and 3 of MCM10 (forward: 5′ GGAGACAAGGAGAACAAAGACC; reverse: 5′ GCTGGCCCAAACATTTCATC) were used to amplify across exon 3 and the PCR product was digested with HPY188III (NEB R0622). Protection from digestion indicated one allele had an insertion/deletion or point mutation disrupting this restriction site and Sanger sequencing was utilized to confirm a mutation that would result in a null allele.
3
siRNA Transfection of Macrophages
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!