Total RNA was extracted from tumor cells using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and from frozen tumor tissues using Sepasol-RNA I Super (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s protocol and subsequently purified with the DNA-free™ DNA Removal kit (Ambion, Austin, TX, USA). The quality of the total RNA was verified using the 260/280 nm ratio and a NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). qRT-PCR was performed using a TaqMan system on an Applied Biosystems StepOne™ machine (Carlsbad, CA, USA) according to the manufacturer’s instruction. Target-specific primers and probes for human GRM1 (Hs00168250_m1), 53BP1 (Hs00996827_m1), CDKN1A (Hs00355782_m1), IL-6 (Hs00174131_m1), CXCL8 (Hs00174103_m1), TNF-α (Hs00174128_m1), VEGFA (Hs00900055_m1), MET (Hs01565584_m1) and 18S ribosomal RNA (18S rRNA, Hs99999901_s1) were purchased from Applied Biosystems. The normalized Ct value of each gene was obtained by subtracting the Ct value for 18S rRNA.
Hs00900055 m1
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Hs00900055_m1 is a TaqMan Gene Expression Assay produced by Thermo Fisher Scientific. It is a pre-designed and validated assay used for the quantification of a specific gene target. The assay includes a fluorogenic probe and primer set designed to detect and measure the expression level of the target gene.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Sepasol rna 1 super, by Nacalai Tesque (1 mentions)
Stepone machine, by Thermo Fisher Scientific (1 mentions)
Dna free dna removal kit, by Thermo Fisher Scientific (1 mentions)
Hs99999901 s1, by Thermo Fisher Scientific (1 mentions)
Maxima cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Hs01113624 g1, by Thermo Fisher Scientific (1 mentions)
Mirvana kit, by Thermo Fisher Scientific (1 mentions)
Amperase ung, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Mt95 4, by Merck Group (1 mentions)
Control human igg, by Merck Group (1 mentions)
Gapdh, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
Hs02758991 g1, by Thermo Fisher Scientific (1 mentions)
Taqman fast advanced master mix solution, by Thermo Fisher Scientific (1 mentions)
6 protocols using hs00900055 m1
1
Quantitative RNA Expression Analysis in Tumor Cells
2
Quantifying VEGFR1, VEGF-A, and miR-520a-3p
3
Quantitative Analysis of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the miRVana kit (Life technologies). The Maxima cDNA synthesis kit (Thermofisher Scientific) was used to generate cDNA and 2 µl cDNA was used for Taqman based quantitative real-time mRNA analysis containing 10 µl Taqman Fast Universal polymerase chain reaction (PCR) master mix (2×) no AmpErase UNG (Life Technologies), 1 µl Taqman primer probe (20×), in up to 20 µl nuclease-free water. GAPDH was used as the normalizer and one-way ANOVA was used to perform statistical analysis. Assay IDs were as follows: Hs01113624_g1 [TNFα], Hs00900055_m1 [VEGFA], Hs00985639_m1 [IL-6], Hs01028901_g1 [NFκB2] (Applied Biosystems, Carlsbad, CA). High capacity cDNA reverse transcription kit was used to generate cDNA for miRNAs. One microliter cDNA was used for Taqman based quantitative real-time mRNA analysis containing 5 µl Taqman Universal PCR master mix (2×) no AmpErase UNG (Life Technologies), 0.5 µl TaqMan microRNA assay (Assay ID 002182, Applied Biosystems), in up to 10 µl nuclease-free water. U6 snRNA (Assay ID 001973) for cellular or miR-223 (Assay ID 000526) for sEVs was used for normalization.
4
Evaluating anti-cancer therapies in NSCLC models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction, reverse transcription to cDNA and real-time quantitative PCR were performed as previously described [25] . The primers used were Hs00174265_m1 for APN/CD13, Hs00900055_m1 for vascular endothelial growth factor (VEGF) and 4352935E for β-actin (all from Applied Biosystems, Framingham, MA, USA).
Orthotopic implantation model EHMES-10 (3×10 6 ) or MSTO-211H (1×10 6 ) cells were injected into the thoracic cavity of SCID mice as previously described [23] and the mice were randomly assigned to control or drug treatment groups. MT95-4 (0.3 or 1 mg•kg -1 ) and control human IgG (Sigma-Aldrich, St Louis, MO, USA) were injected intraperitoneally twice weekly, and cisplatin (3 mg•kg -1 ) was injected i.p. once weekly. All mice were killed on day 28 (EHMES-10) or day 21 (MSTO-211H) after tumour cell inoculation, the thoracic tumours were carefully removed and weighed, and pleural effusions were harvested using a 1 mL syringe, followed by volumetric measurement.
Orthotopic implantation model EHMES-10 (3×10 6 ) or MSTO-211H (1×10 6 ) cells were injected into the thoracic cavity of SCID mice as previously described [23] and the mice were randomly assigned to control or drug treatment groups. MT95-4 (0.3 or 1 mg•kg -1 ) and control human IgG (Sigma-Aldrich, St Louis, MO, USA) were injected intraperitoneally twice weekly, and cisplatin (3 mg•kg -1 ) was injected i.p. once weekly. All mice were killed on day 28 (EHMES-10) or day 21 (MSTO-211H) after tumour cell inoculation, the thoracic tumours were carefully removed and weighed, and pleural effusions were harvested using a 1 mL syringe, followed by volumetric measurement.
5
Gene Expression Analysis of VEGFA and VEGFC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells using an RNeasy minikit (74104; Qiagen) and DNase treated with the RNase-free DNase set (79254; Qiagen). RNA was reverse transcribed with random primers using a RevertAid first-strand cDNA synthesis kit (K1621; Thermo Fisher Scientific). Expression analysis was achieved (by RT-qPCR) using a human VEGFA (Hs00900055_m1; Thermo Fisher Scientific) and human VEGFC (Hs01099203_m1; Thermo Fisher Scientific) TaqMan assay or specific primers for VEGFC-LNC (5′→3′, FW, CCAGGAGCCTCAAACTCTAATC ; and RV, TGCTGCATCCTTGTCCTTAA ) with the FastStart Universal SYBR green master (Rox) assay (4913914001; Merck). Gene expression was normalized to that of GAPDH or ACTB (4333764F and 4333762T, respectively; Applied Biosystems, Foster City, CA), and relative expression was calculated using the ΔΔCT method (where CT is threshold cycle) (118 (link)).
6
VEGF-A Expression Analysis in Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Purelink RNA Mini Kit (ThermoFisher Scientific) was used and the manufacturer's protocol was followed to extract total RNA from cell culture. Reverse transcription was performed using 1 µg of total RNA per 50 µL of reaction volume of TaqMan Reverse Transcription Reagents (ThermoFisher Scientific). Complementary DNA was obtained by incubating the reaction in thermal cycler (Veriti, Applied Biosystem, ThermoFisher Scientific). Real-time quantitative PCR was performed using TaqMan Fast Advanced Master Mix solution (ThermoFisher Scientific) and amplification was achieved using QuantStudio 6. GAPDH expression was used as an internal control. The probes included Hs00900055_m1 (ThermoFisher Scientific) for VEGF-A and Hs02758991_g1 (ThermoFisher Scientific) for GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!