Sirna2

MDA-MB-231 cells were seeded in 6-well plates and transfected with siRNA oligonucleotides (50 nmol per well) with RNAiMAX (Invitrogen). Seventy-two hours after transfection, cells were harvested for further analysis. The siRNAs were synthesized by GenePhama (Shanghai, China) as follows: p97: siRNA1, 5′-GAAUAGAGUUGUUCGGAAU-3′; siRNA2, 5′-GGAGGUAGAUAUUGGAAUU-3′, and SKP2: 5′-GCAGACCTTAGACCTCACAGGTAAA-3′. CEBPD siRNAs were purchased from Dharmacon: D-010453-01 (5′- GGGAGAAGAGCGCCGGCAA-3) and D-010453-02 (5′-GAGAAGAGCGCCGGCAAGA-3′). Non-targeting (NT) siRNA: 5′-UUCUCCGAACGUGUCACGU-3′ was purchased from GenePharma (Shanghai, China). A recombinant lentivirus encoding a doxycycline-inducible shRNA construct targeting p97 was designed using a 21-mer sequence (AACAGCCATTCTCAAACAGAA) as previously reported^{19 (link)} and synthesized by GeneChem Inc. (Shanghai, China).

HEY, 27/87 and JAM cells at 50–60% confluency were transfected with 10 nM of ABCA1-specific siRNAs (siRNA-1 5′ GGAGAUGGUUAUACAAUAGUUUU 3′; siRNA-2 GAAGAAAACUGGUGUCUAU, Dharmacon, Lafayette, CO, USA) or a non-targeting control siRNA (5′ GCACTACCAGAGCTAACTCAGATAGTACT 3′, Dharmacon) using Lipofectamine2000 (Gibco, Waltham, MA, USA) according to manufacturer’s instructions. WEHI-CS62 cells were transfected with the same conditions with the exception that Lipofectamine RNAimax (Gibco) was used as the delivery vehicle.

Three ON-TARGETplus siRNAs directed against human Nup35 were purchased from Dharmacon: siRNA 1, 5′-CUGCUGGUUCCUUCGGUUA-3′; siRNA 2, 5′-AGAUAAAAGUGGCGCUCCA-3′; siRNA 3, 5′-AGUUAUUUCUACC GACACA-3′. HeLa cells were plated at 1.5 × 10⁵ cells per well in 6-well plates and transfected the next day with a final concentration of 40 nM siRNA targeting Nup35 or non-targeting control siRNA (siCONTROL non-targeting siRNA, Dharmacon), using RNAiMAX (ThermoFisher Scientific) according to the manufacturer’s instructions. To generate stable Nup35 knockdown cells, a lentiviral vector and the following GIPZ Lentiviral (GE Healthcare, Dharmacon) shRNAs against hNup35 were used in this study:
GIPZ Lentiviral Human Nup35 shRNA:
V3LHS_364366, TGTCTGTCAGAAATAACCT
V3LHS_380787, TATGAGCTGGTACAACTGG
V3LHS_380788, TGGTTCAGATCCTAACGCG
Lentiviral vector stocks were produced by co-transfection of HEK293T cells with packaging plasmid ΔR8.2, MISSION shRNA or GIPZ Lentiviral shRNA, and pL-VSV-G at a ratio of 1:1:0.5, the culture medium was replaced at 12 h, and viral supernatants were collected and filtered at 48 h. HeLa cells were transduced with the filtered supernatant and selected in 2 ug/ml puromycin.