Total rna mini

RNA was isolated from PBMCs using a commercial column-based extraction kit according to the manufacturer’s protocol (Total RNA Mini, A&A Biotechnology, Gdańsk, Poland). In brief, PBMCs were resuspended on ice post-thaw and centrifuged at 3000× g for five minutes at 4 °C. Subsequently, 200 µL of PBMCs was transferred to a new tube, and 750 µL of Fenozol Plus was added. The RNA was then eluted with 50 µL of ultrapure water, incubated for three minutes, and centrifuged at 15,000× g for one minute at room temperature. The RNA was stored at −80 ± 5 °C. Purity and concentration were assessed via spectrophotometry at 260, 280, and 230 nm wavelengths, with ratios of A260:A230 > 1.7 and A260:A280 > 2.0 indicating a high level of purity.

Cell cultures were performed according to the protocol described in detail in our previous work [26 (link)]. Briefly, we used iCell Endothelial Cells (Cellular Dynamics, Madison, WI, USA), which are purified human endothelial cells differentiated from induced pluripotent stem cells, cultured in Vasculite Maintenance Medium (Cellular Dynamics) according to the manufacturer’s protocol. After obtaining confluence of 70–85%, total RNA was isolated using silica-based minicolumns according to the manufacturer’s protocol (TotalRNA Mini, A&A Biotechnology, Gdansk, Poland). The concentration and purity of the RNA eluent were measured by spectrophotometry (NanoDrop Spectrophotometer 2000, NanoDrop Technologies, Wilmington, DE, USA). The quality and integrity of RNA were assessed with Bioanalyzer (PicoRNA Chip, Agilent Technologies, Santa Clara, CA, USA). The resulting RNA was used to prepare libraries preceded by ribodepletion according to the standard Illumina protocol.

Total RNA was isolated using a standard RNA purification method on minicolumns according to the manufacturer’s protocol (TotalRNA Mini, A&A Biotechnology, Gdansk, Poland). The concentration and purity of the RNA eluent were measured by spectrophotometry (NanoDrop Spectrophotometer 2000, NanoDrop Technologies, Wilmington, DE, USA). Quality and integrity of RNA was assessed with Bioanalyzer (PicoRNA Chip, Agilent Technologies, Santa Clara, CA, USA).

C. jejuni strains were grown on BA plates for 16–18 h as described above. Cells were then harvested from one plate and total RNA was isolated using the Total RNA Mini (A&A Biotechnology), according to the manufacturer’s recommendations. Contaminating DNA was removed using TURBO DNA-free^™ Kit (Invitrogen–ThermoFisher Scientific), according to the manufacturer’s instructions. RNA concentration and RNA quality were measured using Nano Drop 2000 (ThermoFisher Scientific) and 2100 Bioanalyzer (AgilentTechnologies) [93 (link)].

Total cellular RNA was isolated from the frozen liver samples and HepG2 cell pellets with a commercial RNA isolation kit (Total RNA Mini, A&A biotechnology, Poland). RNA concentration was determined on the basis of absorbance at 260 nm; all the samples showed 260/280 nm absorbance ratio of about 2.0. Prior to the reverse transcription, the RNA samples were treated with RNase-free DNase I (Fermentas, International Inc., Canada). First strand cDNA synthesis and the determination of mRNA levels by RT-PCR were performed as described previously [41 (link)], using a CFX Real-Time Detection System (Bio-Rad Laboratories Inc., USA). The primer sequences used in this study are presented in Table 1. β-actin mRNA was used as an internal standard. Relative quantities of the transcripts were calculated using the 2^−ΔΔCT formula [42 (link)]. The amplification of specific transcripts was further confirmed on the basis of the melting curve profiles.
Table 1

The sequences of primers used in this study

Gene	Primer sequence (5′–3′)
HNF1α	F: AAGATGACACGGATGACGATGG
	R: GGTTGAGACCCGTAGTGTCC
HNF4α	F: AAATGTGCAGGTGTTGACCA
	R: CACGCTCCTCCTGAAGAATC
PCSK9	F: TGGCTGCATGACATTGCTTCTC
	R: GCACTGGAGAACCACACAGG
β-actin	F: GAAATCGTGCGTGACATTAAG
	R: GCTAGAAGCATTTGCGGTGGA

DNA and RNA from peripheral blood and frozen tissue sections collected intraoperatively were isolated according to “Blood Mini” and “Total RNA Mini” protocol, respectively (A&A Biotechnology, Poland)^{33 ,34} . The purity and concentration of DNA and RNA samples were assessed nanospectrophotometrically. Concentration of extracted DNA samples range from 25 to 50 ng/ul, for RNA range from 5,2–80 ng/ul to obtain concentration for reverse transcriptase reaction described in the next subsection. Until the analysis, the DNA and RNA samples were stored at −20 °C and at −76 °C, respectively.

Total RNA and DNA were isolated from frozen tissue fragments of colorectal cancer using the column method according to the Total RNA Mini and Genomic Mini protocols (A&A Biotechnology, Poland). The concentration and purity of the RNA samples after isolation were measured spectrophotometrically using the NanoPhotometer™ (IMPLEN, Germany). RNA samples with a calculated A 260/280 absorbance value ranging from 1.8 to 2.0 were selected to perform the reverse transcription reaction. Isolated DNA from tissues showing adequate purity was stored for further analysis.