Dylight 550 nhs

Manufactured by Thermo Fisher Scientific

Sourced in United States

DyLight 550-NHS is a fluorescent dye label that can be used for protein labeling and detection. It has an excitation maximum of 562 nm and an emission maximum of 576 nm, placing it in the orange-red region of the visible spectrum. The NHS ester group allows for covalent attachment of the dye to primary amines on proteins and other biomolecules.

Automatically generated - may contain errors

Lab products found in correlation

3 protocols using dylight 550 nhs

Fluorescent Labeling of Latex Beads

Check if the same lab product or an alternative is used in the 5 most similar protocols

Latex beads of 20nm or 100nm in diameter coated with aliphatic amines (Invitrogen, P7452) were labeled with the STAQ dye. For “randomly labeled” STAQ experiments the beads were separately labeled with rhodamine 6G-NHS (Invitrogen) or DyLight 550-NHS (Thermo Scientific) or DyLight 594 (Thermo Scientific) and ICG-NHS (Dojindo Molecular Technologies) using the provided labeling protocol. After the reaction, the beads were centrifuged for twenty minutes at 5000rpm to separate the reaction buffer from the pelleted beads. To completely remove any unbound dye, the beads were washed and centrifuged repeateadly to remove as much of the free dye as possible. About 1 μL of the dialyzed beads was placed in a Labtek II chamber coverglass (Nuntech). 80 μL of water were added to dilute the beads and allowed to dry. Mounting medium or glycerol was used to cover the dried beads. For alignment of the ‘donut’ STAQ/STED beam and optimization of beam overlap, deep red beads (Invitrogen Inc) 170nm in diameter were used.

ROSALES T., SACKETT D.L., XU J., SHI Z.D., XU B., LI H., KAUR G., FROHART E., SHENOY N., CHEAL S., WU H., DULCEY A., HU Y., LI C., LANE K., GRIFFITHS G.L, & KNUTSON J.R. (2015). STAQ: A route toward low power, multicolor nanoscopy. Microscopy research and technique, 78(5), 343-355.

+ Open protocol

+ Expand

Multimodal Nanoplatform for Cancer Theranostics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Silicon phthalocyanine dichloride (SiPCCl₂), 3‐aminopropyltrimethoxysilane (APTES), Hoechst 33342, tetraethylorthosilicate (TEOS), and 2, 7‐dichlorodihydroflfluorescein diacetate (DCFH‐DA) were obtained from Sigma‐Aldrich. Hexadecyl trimethylammonium chloride (CTAC), triethanolamine (TEA), and FeCl₃ were obtained from Sinopharm Chemical Reagent Co. Ltd. Dylight550‐NHS was purchased from Thermo Fisher Scientific (Waltham, USA). ICG‐NHS was obtained from Xi'an Rixi Biological Technology Co. Ltd (Xi'an, China). Calcein‐AM/propidium iodide (PI), and 1, 3‐diphenylisobenzofuran (DPBF) were obtained from KeyGen BioTech (Shanghai, China). Annexin V‐FITC/PI and CCK8 were obtained from Dojindo Laboratories. Annexin V‐APC/PI was obtained from Jiangsu KeyGEN BioTECH Corp., Ltd (Jiangsu, China) Neutrophil (mouse) isolation Kit was purchased from Cayman Chemical (Michigan, USA). Anti‐CD11c‐APC, anti‐CD137‐APC, anti‐CD11b‐APC, anti‐CD86‐PE‐Cy7, antiCD3‐APC, anti‐CD80‐PE, anti‐CD8‐PE, anti‐Ly‐6G/Ly‐6C‐PE, CD54, CD95, anti‐CD8 antibody, and anti‐CD69‐FITC was purchased from BioLegend, Inc (San Diego, CA, USA). ELISA kits from Neobioscience Technology (Shenzhen, China) were obtained to detect the IFN‐γ, TNF‐α, IL‐12, and IL‐2. H22 mouse liver cancer cell‐specific neoantigen (sequence: HTDAHAQAFAALFDSMH) was obtained from GenScript USA Inc.

Wang Y., Zhao Q., Zhao B., Zheng Y., Zhuang Q., Liao N., Wang P., Cai Z., Zhang D., Zeng Y, & Liu X. (2022). Remodeling Tumor‐Associated Neutrophils to Enhance Dendritic Cell‐Based HCC Neoantigen Nano‐Vaccine Efficiency. Advanced Science, 9(11), 2105631.

+ Open protocol

+ Expand

Fabrication and Characterization of Fluorescent Silica Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

3-aminopropyltrimethoxysilane (APTES), tetraethylorthosilicate (TEOS), anhydrous ethanol, acetone, cyclohexane, and Hoechst 33342 were obtained from Sigma. Hexadecyl trimethylammonium chloride (CTAB) and triethanolamine (TEA) were purchased from Sinopharm Chemical Reagent Co. Ltd. Dylight550-NHS was obtained from Thermo Fisher Scientific (USA). CCK8 assay kits were purchased from Dojindo Laboratories. Anti-CD11c-APC, anti-CD4-FITC, anti-CD86-PE-Cy7, anti-CD3-APC, anti-Foxp3-PE-Cy7, anti-IFN-γ-PE-Cy7, anti-CD80-PE, anti-CD8-PE, anti-TIM-3-FITC and anti-CD25-Percp-Cy5.5 were purchased from BioLegend, Inc. (San Diego, CA, USA). ELISA kits for the detection of IFN-γ, TNF-α, IL-2, IL-6 and IL-12p70 were purchased from Fankewei (Shanghai, China). Mouse liver cancer Hepa1-6 cell-specific NeoAgs (sequence: WDTCTTYKWQKTLEGHD and WDTCTTY KWQKTLEGHD-FAM) were synthesized by GenScript USA Inc. ODN-1826 (Cy3 labeled TCCATGACGTTCCTGACGTT or TCCATGACGTTCCTGACGTT) were synthesized by Sango Biotechnology Co., Ltd, China.

Lin Z., Jiang C., Wang P., Chen Q., Wang B., Fu X., Liang Y., Zhang D., Zeng Y, & Liu X. (2023). Caveolin-mediated cytosolic delivery of spike nanoparticle enhances antitumor immunity of neoantigen vaccine for hepatocellular carcinoma. Theranostics, 13(12), 4166-4181.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!