Anti phospho tbk1

BMDCs (1×10⁶) were infected with MVA at a MOI of 10. At various times post-infection, the medium was removed and cells were collected. Whole-cell lysates were prepared at 1, 2, 4, 6, and 9 h post-infection. Equal amounts of proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the polypeptides were transferred to a nitrocellulose membrane. Phosphorylation of IRF3 was determined using a rabbit polyclonal antibody specific for phosphoserine-396 of IRF3 (Cell Signaling). The level of IRF3 was determined by using a rabbit polyclonal antibody against IRF3. Anti-phospho-TBK1, anti-TBK1 and anti-STING antibodies were purchased from Cell Signaling. Vaccinia E3 protein level was determined by using anti-E3 monoclonal antibody (MAb 3015B2) kindly provided by Dr. Stuart N. Isaacs (University of Pennsylvania) [84] (link). Vaccinia N1 protein level was assessed by using mouse monoclonal anti-N1 antibody (7E5) kindly provided by Dr. Michael Way (Cancer Research UK). Vaccinia H3 protein level was assessed by using rabbit polyclonal anti-H3 antibody (a kind gift from Bernard Moss, NIH). Anti-glyceraldehyde-3-phosphate dehydrogenase (GADPH) or anti-β-actin antibodies were used as loading controls.

The phosphatase inhibitor cocktail and protease inhibitor cocktail were purchased from Sigma-Aldrich (St. Louis, MO, USA). The following antibodies were used: Anti-cGAS (#15102), anti-TBK1 (#3504S), anti-phospho-TBK1 (#5483), anti-IRF3 (#4302), anti-phospho-IRF3 (#4947), anti-α-Smooth Muscle Actin (D4K9N) (#19245), anti-GAPDH (D16H11) (#5174), Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG (all from Cell Signaling Technology, Danvers, MA, USA). Anti-Collagen I (ab6308)) and anti-Collagen III (ab184993) were both purchased from Abcam (Cambridge, MA, USA). The ReverTra Ace qPCR RT Kit (FSQ-101) and SYBR RT-PCR kit (QPK-212) were purchased from Toyobo (Osaka, Japan). LPS was purchased from Sigma-Aldrich. Immunostimulatory DNA (ISD, TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA) was purchased from Invivogen (San Diego, CA, USA).

RAW264.7 (ATCC TIB-71), HEK293T (ATCC-11268), HeLa (ATCC CCL-2), PK-15 (ATCC CCL-33), LFBK (RRID:CVCL_RX26), cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (HyClone) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% antibiotic/antimycotic (Gibco). Cells were maintained in a humidified 5% CO2 incubator at 37°C. Antibodies used for the immunoblot and immunoprecipitation analysis are as follows, anti-Flag (Cell Signaling, 8146), anti-Strep (Qiagen, 34850), anti-GST (Santa Cruz, sc-138), anti-IRF3 (Abcam, ab25950), anti-phospho IRF3 (Ser396) (Cell Signaling, 4947), anti-p65 (Cell Signaling, 4764S), anti-phospho p65 (Cell Signaling, 3031S), anti-TBK1 (Cell Signaling, 3504S), anti-phospho-TBK1 (Cell Signaling, 5483S), anti-β-actin (Santa Cruz,SC 47778), RIG-I (D14G6; 3743), MDA-5 (D74E4; 5321), Anti-FMDV 2B (homemade), anti-Caspase8 (Cell Signaling, 9746S), anti-Caspase3 (Cell Signaling, 9662S) and anti-β-actin (Santa Cruz,SC 47778)

MoDCs were washed in ice-cold phosphate-buffered saline (PBS) and lysed in lysis buffer [150 mM NaCl, 50 mM Tris-HCl (pH 7.6), 5 mM EDTA (pH 8), 1% Nonidet-P-40 (NP-40), 0,5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS)], in the presence of Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific), and benzonase (Sigma-Aldrich) for 25 min on ice. Protein concentration was determined using the Pierce bicinchoninic (BCA) protein assay kit (Thermo Fisher Scientific). Proteins were resolved by SDS–polyacrylamide gel electrophoresis on 4%–20% precast Novex Tris-Glycine gradient gels (Thermo Fisher Scientific) and blotted onto polyvinylidene difluoride (PVDF) membranes (GE Healthcare). Blots were incubated with the indicated primary antibodies, at 1:1000 dilution in 5% (w/v) bovine serum albumin, overnight at 4°C, extensively washed with TBS-T and after incubation with horseradish peroxidase (HRP)–labeled goat anti-rabbit or goat anti-mouse Abs (Cell Signaling Technology), developed with the enhanced chemiluminescence (ECL) detection system as per manufacturer’s instructions (Cyanagen). Primary antibodies anti–phospho-IRF3 at Ser³⁹⁶, anti-IRF3, anti phosphoSTAT1 at Tyr⁷⁰¹, anti-STAT1, anti–phospho-IkBa at Ser³², anti-IkBa, anti–phospho-TBK1, anti IRG1, and anti–β-actin were all purchased from Cell Signaling.

The STING ligands cGAMP and c-di-AMP were purchased from Invivogen. DMXAA and etoposide were obtained from Sigma-Aldrich. Z-VAD-FMK and Rapamycin were obtained from Calbiochem.
Abs specific for anti-cyclin A (C-19, 1:1,000 dilution), anti-cyclin B1 (H-433, 1:1,000 dilution), anti-cyclin E (M-20, 1:1,000 dilution), anti-Cdk1 (17, 1:1,000 dilution), and anti-Cdk2 (H298, 1:1,000 dilution); anti-phospho-S6K1 (#9205, 1:1,000 dilution), anti-phospho-S6 (#2211, 1:1,000 dilution), anti-phospho-4E-BP1 (#9459, 1:1,000), anti-phospho-Akt (#9271, 1:1,000 dilution), anti-phospho-IRF3 (#4947, 1:1,000 dilution), anti-phospho-STAT5 (#9351, 1:1,000 dilution), anti-phospho JAK3 (#5031, 1:1,000 dilution), anti-STING (#13647, 1:1,000 dilution), anti-phospho-TBK1 (#5483, 1:1,000 dilution), anti-ERK (#9102, 1:1,000 dilution), anti-cleaved PARP (#9548, 1:1,000 dilution), anti-cleaved Caspase-3 (#9661, 1:1,000 dilution), anti-TBK1 (#3013, 1:1,000 dilution), anti-IKKε (#2690, 1:1,000 dilution), and anti-IRF3 (#4302, 1:1,000 dilution) were obtained from Cell Signaling Technology; anti-IRF7 (EPR4718, 1:1,000 dilution) was obtained from Abcam; anti-CD98 FITC (10.3, 1:50 dilution) was obtained from MBL. Flow cytometric analysis was performed on a FACSCalibur or LSR Fortessa X-20 and data were analyzed with CellQuest Pro or FlowJo.