Pspcas9n bb 2a puro px459 v2

Glutathione S‐transferase (GST)‐fusion protein constructs including full length, PDZ1, PDZ2, and EB domains were used as described previously [23 (link)].
Two OCCC cell lines, OVISE (RRID:CVCL_3116) and TOV‐21G (RRID:CVCL_3613), were obtained from the National Institute of Biomedical Innovation (Osaka, Japan) and the American Type Culture Collection (Manassas, VA, USA), respectively. They were used within 6 months of thawing and were periodically authenticated by monitoring of cell morphology and growth curve analysis. All experiments were performed with mycoplasma‐free cells. The Me‐EBP50‐knockout (KO) cell line was generated using OVISE cells (which have high Me‐EBP50 expression). Briefly, the guide RNA sequence (gRNA: 5′‐GAGAAGGGTCCGAACGGCTACGG‐3′) was designed using CRISPRdirect (https://crispr.dbcls.jp/: last accessed on 6 June 2021). The complementary oligonucleotides for gRNA were annealed and cloned into pSpCas9n(BB)‐2A‐Puro (PX459) V2.0 (Addgene #62988, Watertown, MA, USA). The pSpCas9n(BB)‐2A‐Puro (PX459) V2.0/gRNA construct was transfected into OVISE cells to establish Me‐EBP50‐KO cell lines. Spindle‐shaped cells were defined as those that showed narrow and elongated phenotypes, along with weak or absent intercellular adhesion.

Four GC cell lines, KE-39 (RCB1434), MKN7 (RCB3687), MKN45 (RCB1001), and MKN74 (RCB1002), were obtained from the RIKEN BioResource Research Center (Ibaraki, Japan). The cells were used within 6 months of thawing and were periodically authenticated by monitoring of cell morphology and growth curve analysis.
The NUCB2-KO cell line was generated using MKN74 cells (which have high NUCB2 expression: Supplementary Fig. S1A), as described previously^{24 (link)}. Briefly, the guide RNA sequence (gRNA: 5′-GAGAAGGGTCCGAACGGCTACGG-3′) was used. The complementary oligonucleotides for gRNA were annealed and cloned into pSpCas9n(BB)-2A-Puro (PX459) V2.0 (#62988) (Addgene, Watertown, MA, USA). The pSpCas9n(BB)-2A-Puro (PX459) V2.0/gRNA construct was transfected into MKN74 cells using LipofectAMINE PLUS (Invitrogen, Carlsbad, CA, USA) to establish the NUCB2-KO lines.

Glutathione S-transferase (GST)-fusion protein constructs including full length, PDZ1, PDZ2, and EB domains, pcDNA3.1-β-catenin delS45, p3xFLAG-CMV14-EBP50, and -2125/-235 pGL3B-Slug were used as described previously [21 (link),22 (link),23 (link)].
CRC cell lines, HCT116, OUMS23, and DLD-1, were obtained from the American Type Culture Collection (Manassas, VA, USA) and the JCRB Cell Bank (National Institute of Biomedical Innovation, Osaka, Japan), respectively. The EBP50-KO cell line was generated using HCT116 cells (Supplementary Figure S2A). The guide RNA sequence (gRNA: 5′-GAGAAGGGTCCGAACGGCTACGG-3′) was used. The complementary oligonucleotides for gRNA were annealed and cloned into pSpCas9n(BB)-2A-Puro (PX459) V2.0 (#62988) (Addgene, Watertown, MA, USA). The pSpCas9n(BB)-2A-Puro (PX459) V2.0/gRNA construct was transfected into HCT116 cells and EBP50-KO lines were established as described previously [22 (link)].