Log In Sign up
The largest database of trusted experimental protocols

Ambion silencer select

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, United Kingdom

Ambion Silencer Select is a laboratory equipment product designed for gene silencing applications. It utilizes small interfering RNA (siRNA) technology to selectively target and downregulate the expression of specific genes in a wide range of cell types.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (6 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Rnaimax, by Thermo Fisher Scientific (2 mentions) Rnaifect, by Qiagen (1 mentions) Sigenome smartpool sirna, by Horizon Discovery (1 mentions) Allstars hs cell death sirna, by Qiagen (1 mentions) Silencer select, by Thermo Fisher Scientific (1 mentions) Hiperfect transfection reagent, by Qiagen (1 mentions) Opti mem medium, by Thermo Fisher Scientific (1 mentions) Puromycin, by InvivoGen (1 mentions) Nucleofector 2b device, by Lonza (1 mentions) Rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions) F12 medium, by Thermo Fisher Scientific (1 mentions) On targetplus smartpool, by Horizon Discovery (1 mentions)

Close spelling variants of this product

Ambion Silencer Select siRNAs Ambion® Silencer® Select Predesigned siRNAs Ambion-Silencer Select validated siRNA Ambion Silencer® Select Pre-designed siRNA Silencer Select

18 protocols using ambion silencer select

1

RhoGDI, Ubc9, and PIAS Double Knockdown Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were subjected to a double knock-down protocol using Lipofectamine RNAiMAX (Life Technologies) to deliver 10 nM of RhoGDIα (#1: s698 - CCAGCAUACGUACAGGAAA, #2: s699 - GUCUAACCAUGAUGCCUUA, #3: s700 - CCAUGAUGCCUUAACAUGU, Ambion Silencer Select, Life Technologies), RhoGDIβ (#1: s455 - GGAAGGUUCUGAAUAUAGA, #2: s456 - CCAUGGACCUUACUGGAGA, #3: s224014 - GUGGAUAAAGCAACAUUUA, Ambion Silencer Select, Life Technologies), Ubc9 (stealth predesigned UBE2IHSS111130 - UCGAACCACCAUUAUUUCACCCGAA, Life Technologies) or 100 nM PIAS1-4 (PIAS1 – GGAUCAUUCUAGAGCUUUA, PIAS2 – CUUGAAUAUUACAUCUUUA, PIAS3 – CCCUGAUGUCACCAUGAAA, PIAS4 – GGAGUAAGAGUGGACUGAA) [23] (link) siRNA oligos. As a control, 100 nM of Luciferase (CGUACGCGGAAUACUUCGA, Sigma) siRNA oligo was used. Cells were transfected 48 and 24 hours before harvest.
Schou J., Kelstrup C.D., Hayward D.G., Olsen J.V, & Nilsson J. (2014). Comprehensive Identification of SUMO2/3 Targets and Their Dynamics during Mitosis. PLoS ONE, 9(6), e100692.
+ Open protocol
+ Expand
2

Transient transfection of cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
All three cell lines were transiently transfected using a final concentration of 50 nM of two different siRNAs targeting PANTR1 (siRNA 1 #n507582, siRNA 2 #n507583; Ambion Silencer Select, Ambion, Austin, TX, USA) according to the fast forward protocol of HiPerFect Transfection Reagent (Qiagen, Hilden, Germany). Non-targeting negative control siRNA (Silencer Select negative Control No.1 siRNA #4390843; Ambion Silencer Select, Ambion, Austin, TX, USA) and cell death control (AllStars Hs Cell Death siRNA # SI04381048, Qiagen, Hilden, Germany) served as references.
Seles M., Hutterer G.C., Foßelteder J., Svoboda M., Resel M., Barth D.A., Pichler R., Bauernhofer T., Zigeuner R.E., Pummer K., Slaby O., Klec C, & Pichler M. (2020). Long Non-Coding RNA PANTR1 is Associated with Poor Prognosis and Influences Angiogenesis and Apoptosis in Clear-Cell Renal Cell Cancer. Cancers, 12(5), 1200.
+ Open protocol
+ Expand
3

Knockdown of APP and TDP-43 in SH-SY5Y Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SH-SY5Y cells were differentiated for 7 days as described and then nucleofected with siRNA duplexes targeting either APP (100 nM; Ambion Silencer Select, Thermo Fisher Scientific; ID s229520, siRNA #1 or Dharmacon ON-TARGETplus SMARTpool, Horizon Discovery Cambridge, U.K.; Cat #L-003731-00-005, siRNA #2), TDP-43 (120 nM; Ambion Silencer Select, Thermo Fisher Scientific; ID s23879, siRNA #1 or Dharmacon ON-TARGETplus SMARTpool, Horizon Discovery Cambridge, U.K.; Cat #L-012394-00-005, siRNA #2) or a non-targeting control (Negative Control siRNA; Qiagen, Manchester, U.K.) according to the manufacturer’s instructions (Amaxa 4D-Nucleofector; programme CA-137). Cells were further cultured for 72 h and target knockdown verified using immunoblotting.
Hicks D.A., Jones A.C., Pickering-Brown S.M, & Hooper N.M. (2020). The cellular expression and proteolytic processing of the amyloid precursor protein is independent of TDP-43. Bioscience Reports, 40(4), BSR20200435.
+ Open protocol
+ Expand
4

Knockdown of EHBP1L1, CD2AP, and CIN85

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNAs for EHBP1L1 (Sigma-Aldrich siRNA SASI_Hs02_00320623, Qiagen siRNA #SI00377055), CD2AP (Ambion Silencer select #s24191 and #s24193, Thermo Fisher Scientific), and CIN85 (Ambion Silencer select #s26895 and #s26897, Thermo Fisher Scientific), as well as a negative control (Ambion Silencer select negative control No. 1 #4390843, Thermo Fisher Scientific) were used.
Iwano T., Sobajima T., Takeda S., Harada A, & Yoshimura S.I. (2023). The Rab GTPase-binding protein EHBP1L1 and its interactors CD2AP/CIN85 negatively regulate the length of primary cilia via actin remodeling. The Journal of Biological Chemistry, 299(3), 102985.
+ Open protocol
+ Expand
5

Knockdown of p38α/β in Aged MuSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To knock down p38α/β expression, we cultured aged MuSCs on collagen-coated tissue culture plastic for one day, collected them by incubation with 0.5% trypsin in PBS for 2 min at 37 °C and then transferred them to laminin-functionalized hydrogels for six more days. We transfected siRNA sequences (Ambion Silencer Select from Life Technologies, Carlsbad, CA) targeting p38α (Mapk14; ID: s77114) or p38β (Mapk11; ID: s72152) or scrambled control (100 nM; ID: negative control #2) at 100 nM once on the first day of culture using siIMPORTER reagents (Upstate, Charlottesville, VA). To test the specificity of individual siRNAs (each at 100 nM), we assayed the expression of p38α (Mapk14) and p38β (Mapk11) by RT-qPCR at day 3 post-treatment and compared to cells treated with the scramble control (100nM; Supplementary Fig. 4a,b). To test the efficacy of pooled p38α/β siRNAs (100nM each), we assayed the expression of p38α (Mapk14) and p38β (Mapk11) by RT-qPCR at day 5 post-treatment and compared to cells treated with the scramble control (200nM; Supplementary Fig. 4c,d). We also assayed phospho-HSP27, cell proliferation, and myogenic gene expression in cultured aged MuSCs treated with pooled 100 nM p38α/β siRNAs or 200 nM scrambled control (Fig. 3a–c, g, and h).
Cosgrove B.D., Gilbert P.M., Porpiglia E., Mourkioti F., Lee S.P., Corbel S.Y., Llewellyn M.E., Delp S.L, & Blau H.M. (2014). Rejuvenation of the aged muscle stem cell population restores strength to injured aged muscles. Nature medicine, 20(3), 255-264.
+ Open protocol
+ Expand
6

Targeting c-Myc and p53 in Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
MM.1S cell line was transfected with 15 pico-mole of c-Myc siRNA (Ambion Silencer Select, Life Technologies) using Lipofecatmine RNAiMAX. Knocking-down of the protein was confirmed with Western blotting. Additionally, 24h after transfection cells were treated with 10μM PRIMA-1Met and incubated for additional 24 h. Viability of cells was determined using MTT assay as described above.
Saha M.N., Abdi J., Yang Y, & Chang H. (2016). miRNA-29a as a tumor suppressor mediates PRIMA-1Met-induced anti-myeloma activity by targeting c-Myc. Oncotarget, 7(6), 7149-7160.
+ Open protocol
+ Expand
7

Knockdown of p38α/β in Aged MuSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To knock down p38α/β expression, we cultured aged MuSCs on collagen-coated tissue culture plastic for one day, collected them by incubation with 0.5% trypsin in PBS for 2 min at 37 °C and then transferred them to laminin-functionalized hydrogels for six more days. We transfected siRNA sequences (Ambion Silencer Select from Life Technologies, Carlsbad, CA) targeting p38α (Mapk14; ID: s77114) or p38β (Mapk11; ID: s72152) or scrambled control (100 nM; ID: negative control #2) at 100 nM once on the first day of culture using siIMPORTER reagents (Upstate, Charlottesville, VA). To test the specificity of individual siRNAs (each at 100 nM), we assayed the expression of p38α (Mapk14) and p38β (Mapk11) by RT-qPCR at day 3 post-treatment and compared to cells treated with the scramble control (100nM; Supplementary Fig. 4a,b). To test the efficacy of pooled p38α/β siRNAs (100nM each), we assayed the expression of p38α (Mapk14) and p38β (Mapk11) by RT-qPCR at day 5 post-treatment and compared to cells treated with the scramble control (200nM; Supplementary Fig. 4c,d). We also assayed phospho-HSP27, cell proliferation, and myogenic gene expression in cultured aged MuSCs treated with pooled 100 nM p38α/β siRNAs or 200 nM scrambled control (Fig. 3a–c, g, and h).
Cosgrove B.D., Gilbert P.M., Porpiglia E., Mourkioti F., Lee S.P., Corbel S.Y., Llewellyn M.E., Delp S.L, & Blau H.M. (2014). Rejuvenation of the aged muscle stem cell population restores strength to injured aged muscles. Nature medicine, 20(3), 255-264.
+ Open protocol
+ Expand
8

siRNA Knockdown of Cytoskeletal Regulators

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The following duplexed siRNAs (predesigned Ambion Silencer Select) were obtained from Life Technologies: LIMK 1, 156129 and s69232; LIMK 2, 156133 and s69236; TPPP/p25, s91408 and s91407; nonmuscle cofilin, Cfl1, s63902; cdc42 siRNA, s63741; and negative control siRNA # 1. SMGs were transfected with 500 nM siRNA using RNAiFect (Qiagen, Valencia, CA) and cultured for 24–48 h, as we reported previously (Daley et al., 2009 (link))
Ray S., Fanti J.A., Macedo D.P, & Larsen M. (2014). LIM kinase regulation of cytoskeletal dynamics is required for salivary gland branching morphogenesis. Molecular Biology of the Cell, 25(16), 2393-2407.
+ Open protocol
+ Expand
9

Transfecting Endothelial Cells with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Endothelial cells were reverse-transfected with small interfering RNA (Ambion silencer select, Life technologies) targeted to S1P3 (cat. no. s4455 and s4453), SR-BI (cat. no. s2648, s2649, and s2650) or LDLR (cat. nos. s224006, s224007, and s4) or ACVRL1 (cat. nos. s986, and s988) and non-silencing control (cat. no. 4390843) at a final concentration of 5 nmol/L using Lipofectamine RNAiMAX transfection reagent (Invitrogen, 13778150) in an antibiotic-free medium. All experiments were performed 72 h post-transfection, and the efficiency of transfection was confirmed with at least two siRNAs against each gene using quantitative RT-PCR and western blotting.
Velagapudi S., Wang D., Poti F., Feuerborn R., Robert J., Schlumpf E., Yalcinkaya M., Panteloglou G., Potapenko A., Simoni M., Rohrer L., Nofer J.R, & von Eckardstein A. (2023). Sphingosine-1-phosphate receptor 3 regulates the transendothelial transport of high-density lipoproteins and low-density lipoproteins in opposite ways. Cardiovascular Research, 120(5), 476-489.
+ Open protocol
+ Expand
10

Reverse Transfection of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 786-O and 786-O-VHL cells were reverse transfected with siRNA (Ambion Silencer Select; Life Technologies) targeted to LDLR (s224006, s224007, s4), VLDLR [siGENOME SMARTpool siRNA D-003721-02; ON-TARGET plus human VLDLR (7436), Dharmacon], neuropilin-1 (NRP1) (s16844, s16843), or nonsilencing control (4390843, silencer select or siGENOME control siRNA D-001220-01-20, Dharmacon or ON-TARGET control siRNA D-01810-10-20, Dharmacon) at a final concentration of 5 nmol/l using Lipofectamine RNA iMAX transfection reagent (Invitrogen; 13778150) in an antibiotic-free medium. All experiments were performed 72 h posttransfection and efficiency of transfection was confirmed with at least two siRNAs against each gene using quantitative RT-PCR.
Velagapudi S., Schraml P., Yalcinkaya M., Bolck H.A., Rohrer L., Moch H, & von Eckardstein A. (2018). Scavenger receptor BI promotes cytoplasmic accumulation of lipoproteins in clear-cell renal cell carcinoma. Journal of Lipid Research, 59(11), 2188-2201.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!