Applied biosystems fast sybr green master mix

The same set of mRNA used for the microarray was also used for qPCR validations. The primers were designed based on the known Ovis aries and Bos taurus genomes (Table 1) for SYBR green or TaqMan chemistry. Chemistries used for this analysis were Applied Biosystems Fast SYBR Green master mix, and Taqman Fast Advanced master mix (Cat. # 4385612, 4444558, respectively; Thermo-Fisher Scientific, Waltham, MA, United States). The ovine β-actin primers and probe were used as the house keeping gene control, as described previously (Chang et al., 2016b (link)). Bacterial 16S rRNA was measured using universal 16S primers as described by Nadkarni and coworkers (Nadkarni et al., 2002 (link)). For each sample, the relative mRNA expression was calculated by the difference in threshold cycle (ΔC_t) between the triplicate mean C_t for each gene and for β-actin.

Cells in six-well plates were transfected with 1 μg human or cow CD44-promoter-pNL2.1 or empty vector pNL2.1 using Lipofectamine 3000 (Invitrogen) as manufacturer’s instructions. Total RNAs from cells were isolated using RNeasy Plus Micro Kit (QIAGEN) according to the manufacturer’s protocol. After digestion by RNase-Free DNase Set (QIAGEN), RNAs were reverse-transcribed according to iScript cDNA Synthesis Kit (Thermo Fisher Scientific). Real-time polymerase chain reaction (PCR) was performed using an Applied Biosystems™ Fast SYBR™ Green Master Mix (Thermo Fisher Scientific). Primer sequences used for real-time PCR are Nluc-1F: CAGGGAGGTGTGTCCAGTTT, Nluc-1R: TCGATCTTCAGCCCATTTTC for evaluation of CD44-promoter-driven Luciferase activity; Hygr-1F: GAGCCTTCAGCTTCGATGTC, Hygr-1R: CGGTACACGTAGCGGTCTTT for evaluation of the expression of hygromycin driven by constitutive promoter. TBP expression was used for normalization. The 2^−ΔΔCt method was used for data analysis.
For detecting endogenous cow and human CD44 expression, the primer sequences used for real-time PCR were listed as follows:

Bt-CD44-Forwad: TACAGCATCTTCCACACGCA

Bt-CD44-Reverse: GCCGTAGTCTCTGGTATCCG

Bt-TBP-2F: GCACAGGAGCCAAGAGTGAA,

Bt-TBP-2R: TTCACATCACAGCTCCCCAC

Hs-CD44-1F: GATGGAGAAAGCTCTGAGCATC

Hs-CD44-1R: TTGCTGCACAGATGGAGTTG

Hs-TBP-1F: GGAGAGTTCTGGGATTGTAC

Hs-TBP-1R: CTTATCCTCATGATTACCGCAG

TBP was used for normalization.

TRIzol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from pancreatic tissues and cell lines. The PrimeScript RT Reagent Kit (TaKaRA Bio Inc., Shiga, Japan) was used for reverse transcription, according to the manufacturer’s instructions. Applied Biosystems Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) was used for the quantitative real-time PCR (qRT-PCR) assay. ACTB and U6 were employed as mRNA and miRNA internal controls, respectively. A list of primer sequences used in this study is provided in Supplementary Table 4, Online Resource 1.

Total RNA was isolated with the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA was synthesized with iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad) according to the manufacturer's recommendations. Then, qRT-PCR was performed using specific oligonucleotide primers for murine gapdh, ptgs1, ptgs2, ptges, col3a1, col4a1, col4a2, col8a1, col16a1, and col18a1 genes (all purchased from Qiagen). Murine gapdh served as a reference gene. Amplification products were detected with Applied Biosystems Fast SYBR Green Master Mix (Thermo Fisher Scientific). PCR was performed with the following protocol using Mastercycler Realplex (Eppendorf): initial denature for 60 seconds at 95°C, amplification with 40 cycles of 10 seconds at 95°C for DNA denature and 30 seconds at 60°C for primer annealing and extension. The relative fold gene expression of samples was calculated using the 2^−ΔΔC_t method.