Mixed cells (FaDu: HF: THP-1 = 2 104:1 104:1 104) were cultured in the conventional 6-well cell culture plate (2D-4-culture) and 6-well SPL3D cell floater plate (3D-4-culture) respectively, with high-glucose DMEM medium supplemented with 10% (v/v) FBS (all from KeyGEN BioTECH). Single HUVECs were seeded in Transwell inserts at a density of 1 × 104 cells, with high-glucose DMEM medium supplemented with 10% (v/v) FBS (all from KeyGEN BioTECH). To quantify the number of migrated HUVECs, images from three different fields of view were captured and analyzed using Image J software (version 1.51j8).
Fetal bovine serum (fbs)
Manufactured by Keygen Biotech
Sourced in China, United States
FBS (Fetal Bovine Serum) is a widely used cell culture medium supplement. It is derived from the blood of bovine fetuses and provides various growth factors, hormones, and other essential nutrients to support the growth and proliferation of cells in vitro.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco modified eagle medium (dmem), by Keygen Biotech (7 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Dulbecco s modified eagle s medium dmem, by Keygen Biotech (5 mentions)
Rpmi 1640 medium, by Keygen Biotech (4 mentions)
Streptomycin, by Keygen Biotech (4 mentions)
Penicillin, by Keygen Biotech (4 mentions)
Penicillin streptomycin solution, by Keygen Biotech (3 mentions)
3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide mtt, by Merck Group (3 mentions)
Dmem medium, by Keygen Biotech (2 mentions)
1640 medium, by Keygen Biotech (2 mentions)
Penicillin streptomycin, by Keygen Biotech (2 mentions)
Dulbecco s modified eagle s medium, by Keygen Biotech (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Lysotracker red, by Keygen Biotech (2 mentions)
Dmem high glucose medium, by Keygen Biotech (1 mentions)
Phosphate buffered saline (pbs), by Keygen Biotech (1 mentions)
Hepg2, by American Type Culture Collection (1 mentions)
Minimum essential medium (mem), by Keygen Biotech (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Leibovitz s l 15, by Thermo Fisher Scientific (1 mentions)
38 protocols using fetal bovine serum (fbs)
1
Evaluating Migration of HUVECs in 2D and 3D
2
Isolation and Culture of Rat Bone Marrow MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MSCs derived from bone marrow were obtained from 60 male Sprague-Dawley (SD) rats (aged 8 weeks), and they were identified based on their surface phenotypes and multipotency, as previously described13 (link),19 (link). The bone marrow in the rat femur was flushed with low-glucose Dulbecco’s modified Eagle’s medium (DMEM; KeyGEN, Nanjing, Jiangsu, China) containing 10% fetal bovine serum (FBS; KeyGEN). The bone marrow fluid was put into 10 ml centrifuge tubes , and 3 ml phosphate-buffered saline (PBS; KeyGEN) was added. Then, it was centrifuged for 10 min at 1000 r/min. The supernatant was abandoned, and the remaining cells were washed twice with PBS and spun at 1000 r/min for 10 min. After washing, 5 ml DMEM was added to the cell suspension, and then the cells were cultured in culture dishes with 5% carbon dioxide (CO2)/95% air at 37 °C. When the cells reached 80% to 90% confluence, they were resuspended by trypsin. The subculture was plated at about 2 × 106 cells per dish. MSCs from passages 3 to 4 were used for all experiments.
3
Cell Line Preparation for Exosome Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human HCC cell line HepG2 was obtained from the American Type Culture Collection (ATCC) and cultured in MEM (KeyGEN BioTECH, China) supplemented with 10% FBS (Gibco, USA) in a humidified incubator with 5% CO2 at 37 °C. The human normal liver cell line LO2 and the human HCC cell lines MHCC97L, MHCC97H, and HCCLM3 were obtained from the Cell Bank of the Chinese Academy of Sciences and cultured in DMEM (KeyGEN BioTECH) supplemented with 10% FBS in a humidified incubator with 5% CO2 at 37 °C. All cell lines were authenticated by the short tandem repeat (STR) profiling and tested for mycoplasma contamination. Exosome-depleted FBS was obtained by ultracentrifugation at 100,000 × g overnight at 4 °C. All cells ready for exosome isolation were cultured in medium supplemented with 10% exosome-depleted FBS in a humidified incubator with 5% CO2 at 37 °C.
4
Modulation of Oxol-LDL-Induced VSMC Dysfunction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco’s modified Eagle medium (DMEM; KeyGEN Biotech, Nanjing, China) with 10% fetal bovine serum (FBS; KeyGEN Biotech) was placed in an incubator at 37 ℃ with 5% CO2 to culture human VSMCs (iCell Bioscience Inc., Shanghai, China). The VSMCs of passage 4 were used in the following experiments. To construct an in vitro cell model of AS, VMSCs were treated with 50 mg/L oxidized low-density lipoprotein (ox-LDL; Biosynthesis Biotechnology Company, Beijing, China) for 24 hours. To evaluate the impacts of Sar on ox-LDL-treated VSMCs, VSMCs were pretreated by Sar (1, 2, or 4 µM; Aladdin, Shanghai, China) for 24 hours prior to incubation with 50 mg/L ox-LDL.
5
Establishment of Radioresistant NPC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NPC cell lines (CNE1, CNE2, and CNE1‐LMP1) were a gift from the Cancer Research Institute of Central South University (Changsha, China). The CNE2‐radioresistance (CNE2R) cell line was constructed from a poorly differentiated CNE2 cell line by exposing to progressively increasing radiation over the course of 6 months. Briefly, CNE2 cells were irradiated every 2 weeks with 2, 4, 6, and 8 Gy, and each dose was repeated for three times so that the CNE2 cells were exposed to a total dose of 60 Gy. CNE2 and CNE2R cell lines have been authenticated using STR DNA profiling analysis. All NPC cell lines were cultured in RPMI‐1640 medium (KeyGEN, Jiangsu, China) containing 10% fetal bovine serum (FBS, Gibco Life Technologies, Grand Island, NY, USA) and 1% penicillin‐streptomycin solution (Hyclone, Thermo Scientific, Marietta, OH, USA) at 37°C in 5% CO2. Human breast carcinoma cell line MCF7 and lung cancer cell line A549 were maintained in our laboratory and grown in DMEM medium (KeyGEN, Jiangsu, China) containing 10% FBS and 1% penicillin‐streptomycin solution at 37°C in 5% CO2.
6
Culturing Colorectal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human colorectal carcinoma cell lines RKO, HCT116, HT-29, human normal colon epithelial cell line FHC and 293 T were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Cat#11965092, Gibco, USA) with 10% fetal bovine serum (FBS, Cat#16140071, Gibco, USA) and 1% penicillin and streptomycin (Cat#KGY0023, KeyGEN BioTECH, China). SW480 and SW620 were maintained in Leibovitz’s L-15(Cat#11415114, Gibco, USA) supplemented with 10% FBS and 1% penicillin and streptomycin (Cat#KGY0023, KeyGEN BioTECH, China). All cells were maintained at 37 °C with 5% CO2. The cell lines were donated by the State Key Laboratory of Oncogenes and Related Genes of Shanghai Cancer Institute, and were recently authenticated by STR profiling and tested for mycoplasma contamination.
7
Lung Cancer Cell Lines Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human lung adenocarcinoma cell line H1975 and human lung squamous cell carcinoma cell line H226 were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). Cells were maintained in a humidified cell incubator with 5% CO2 at 37 °C in DMEM supplemented with 10% FBS (KeyGEN, Nanjing, China). Cells were plated onto 6-well plates at a density of 3 × 105 cells per well. Cells at 60–70% confluency were transfected with SLC3A2 siRNA1, sense: GGACCUCACUCCCAACUAUTT, antisense: AUAGUUGGGGAGUGAGGUCCTT; SLC3A2 siRNA2, sense: CAGATCCTGAGCCTACTCGAA, antisense: TCCGTGTCATTCTGGACCTTA; and scrambled siRNA: AATTCTCCGAACGTGTCACGT (Qiagen, Shanghai, China).
8
Premalignant Leukoplakia Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leuk-1, a premalignant leukoplakia cell line, was cultured in a defined keratinocyte serum-free medium (K-SFM; GIBCO, Invitrogen, Grand Island, USA). The OSCC cell line CAL 27 and human immortalized keratinocyte line (HaCaT) were cultured in a complete Dulbecco's modified Eagle's medium (DMEM, Key GEN Bio TECH, China) medium with 10% Fetal Bovine Serum (FBS, BI, Israel). These cells were cultured in an incubator at 37 °C with 5% CO2.
9
Oxidative Stress Response in PC12 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PC12 cells were purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences and were cultured in high-glucose DMEM (Nanjing KeyGen Biotech Co., Ltd.) supplemented with 10% FBS (cat. no. 16000-044; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin solution at 37˚C and 5% CO2. The cells were digested with 0.25% trypsin containing EDTA and passaged. When the cells reached 80% density, following 10 h of serum starvation, different concentrations of H2O2 or AVLE were added to the medium to screen for the optimum concentration. To evaluate the effect of AVLE on oxidative stress, the PC12 cells were pre-treated with AVLE for 2 h before subsequent experimentation and continued with treatment in the corresponding groups. To inhibit autophagy, cells were treated with 3-methyladenine (3-MA, 5 mM) prior to AVLE treatment.
10
Inflammasome Activation in BV-2 and bEND3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BV-2 cells mouse brain endothelial cells bEND3 were cultured in humidified 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) FBS, penicillin (100 U/ml), and streptomycin (100 U/ml) (KeyGEN). For inducing inflammasome activation, 105 cells were plated in 6-well plate overnight, and the medium were changed to serum-free medium next morning and then the cells were treated with morphine (200 μM) with or without metformin for 6 h. Metformin (4, 20, or 100 μM) was administrated 15 min before morphine treatment. Cell extracts and precipitated supernatants were analyzed by immunoblotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!