Anti mdm2

pCMV-myc3-HDM2 (Addgene Plasmid #20935) was a gift from Yue Xiong, pcDNA3 flag p53 (Addgene plasmid # 10838) was a gift from Thomas Roberts, HA-tagged ubiquitin plasmids (WT, K48, and K63) were gift from Ted Dawson [16 (link)]. LentiCRISPRv2 was a gift from Feng Zhang (Addgene plasmid # 52961), and sgRNA specificly targeting human MYL6B (6Bsg1: ACTTTGGAGAGATCGACTGG; 6Bsg2: TTATACTTTAGAGTTCAAGG and 6Bsg3: TTCCCGTGAAGAAACCAGCA) were cloned into LentiCRISPRv2 following provider’s guide. Myc-DDK-tagged Human MYL6B ORF sequence was cloned into pCMV6 (OriGene). 3FLAG-tagged MYL6B ORF sequence was cloned into pcDNA3. Rabbit polyclone antibodies anti-p53, anti-Bax, anti-MYL6B, anti-MDM2 and mouse monoclone antibody anti-GAPDH were from Proteintech Inc. Rabbit polyclone antibody anti-ubiquitin were from Dako. Mouse monoclone anti-FLAG M2, anti-FLAG M2 Affinity Agarose Gel, and anti-c-Myc Affinity Agarose Gel was from Sigma-Aldrich.

The primary antibodies used in this study included anti-Akt, anti-p-Akt, anti-CCND1, anti-E2F1, anti-p-MDM2, and anti-P27 (Cell Signaling Technology, USA) and anti-TRIB3, anti-E-cadherin, anti-MMP9, anti-H3 and anti-GAPDH (Abcam, USA), and anti-MDM2 (Proteintech, USA). The goat anti-rabbit or anti-mouse secondary antibodies were purchased from Kangwei Ltd. Beijing, China.
To determine the protein levels in cells, total protein was extracted using RIPA with a Protease Inhibitor Cocktail. Then, 30 µg of protein was subjected to 10% SDS–PAGE gel electrophoresis and transferred to a polyvinylidene fluoride membrane. After the membrane was blocked with 5% skim milk for 1 h, blots were incubated with primary antibodies. Finally, the blots were incubated with secondary antibodies after being washed with TBST.