Sensimix sybr green

Tissue samples were homogenized in Trizol (Invitrogen) using the MagnaLyser beads followed by RNA isolation and gene expression analysis as described by the manufacturer. 1μg of mRNA was converted by reverse transcription into cDNA using iScript cDNA synthesis kit (BioRad, Uppsala, Sweden). Real time quantitative PCR (RT-PCR) was performed with 15 ng cDNA, 1μM specific primer pairs and 5μl SensiMix SYBRgreen (Bioline, UK) in a total volume of 10 μl using the CFX 384 system (BioRad) as follows: initial denaturation at 95°C for 10 min, followed by 42 cycles of 30s at 95°C, 1 min at 55°C for annealing and 40 secs at 72°C for elongation. The amplification was ended with a melting curve starting after 40 cycles. Gene expression was calculated using acidic ribosomal phosphoprotein P0 (ARPP0 or 36B4) as a housekeeping gene. Relative gene expression was calculated using 2 ^ΔΔCt. Intron-exon spanning primer sequences were designed using the Primer3 program and are listed in S1 Table.

To quantify the total number of plasmids from the library, a set of primers annealing to the vector was used:
5′-TTTCTGCGGACTGGCTTT-3′ (qPZeroFwd)
5′-ACAGGATTAGCAGAGCGAGG-3′ (qPZeroRev).
To quantify plasmids containing PC86 (as a representative metagenomic hit), primers annealing to the inserted PC86 sequence were designed:
5′-ATACCGACGAAGCCCTGT-3′ (qPC86Fwd)
5′-TCGGCAGGGTCATACACATA-3′ (qPC86Rev).
All primers were supplied by Invitrogen Life Technologies. Quantitative real-time PCR experiments (see also Supplementary Fig. 10) were performed in triplicate using Sensimix SYBR green (Bioline) in the Rotor-Gene 6000 (Corbett Life Sciences). The PCR conditions were as follows: initial DNA denaturation at 95 °C for 10 min, 40 cycles (95 °C for 10 s; 52 °C for 15 s; 72 °C for 20 s) and a temperature gradient enabling determination of the DNA melting temperature (between 72 °C and 95 °C). Reference curves using both sets of primers were obtained with correlation coefficients R²>0.99.

Quantitative PCR (qPCR) was conducted with SensiMix SYBR Green (Bioline) as described in Supplementary Material.

Using the QIAGEN RNeasy kit, RNA was isolated from prefrontal cortex, hippocampal and cerebellar tissue from individual animals (Cohort 5). Samples were DNAase treated using TURBO DNA‐free™ Kit (Ambion Life Technologies), following the recommended protocol. cDNA synthesis was performed using the RNA to cDNA EcoDry™ Premix (Random Hexamers) synthesis tubes (Clontech), heated at 42°C for 75 min, followed by 80°C for 15 min. qPCR was conducted with SensiMix SYBR Green (Bioline) on the StepOne Plus (Life Technologies; 1 cycle 95°C, 10 mins; 45 cycles of 95°C, 15 s and 60°C, 1 min; with melt curves conducted 55°C, 1 min; 95°C for 15 s). All qPCR samples were run in triplicate and the outcome was calculated using 2^‐ΔΔCt method, normalised to UBC and SDHA housekeeping genes. Primer sequences are given in Table 2.

Cells were grown in triplicate on 12-well plates and treated as described in figure legends. Total RNA was harvested using TRI Reagent (Sigma-Aldrich), and reverse transcribed into cDNA using the SuperScript III First Strand cDNA Synthesis Kit (Life Technologies). mRNA levels were determined by qRT-PCR using SensiMix SYBR Green (Bioline) on a Corbett Rotorgene 3000 (Corbett Life Sciences, Sydney, Australia) using primers for IQGAP1 (F: AAGAAGGCATATCAAGATCGG, R: CCTCAGCATTGATGAGAGTC), ABCA1 [55 (link)], HMGCR [56 (link)] and the housekeeping gene, porphobilinogen deaminase, PBGD [55 (link)]. The mRNA expression levels were normalized to that of PBGD and made relative to the vehicle condition using the ΔΔCt method.

The Total RNA plus kit (Norgen Biotek Corp, Canada) was used to isolate RNA from cell and tissues according to the manufacturer’s instructions. Following stimulation, the medium was aspirated and cell monolayers were washed twice with ice-cold PBS and lysed directly in buffer RL. Mouse tissues were disaggregated in ice-cold buffer RL using a Precellys 24 tissue homogenizer set at 2 cycles a 6500 rpm for 20 s with a 30 s interval at 4 °C. Total RNA was extracted and subjected to DNase-1 digestion and ~ 1 μg was reverse transcribed with oligo-dT₁₈ primers using the First Strand Synthesis Kit (Promega) for 1 h at 48 °C. Real-time qPCR was performed using a Rotagene RG-3000 (Qiagen) under the following amplification conditions: 95 °C for 10 min, followed by 45 cycles of 95 °C, 10 s; 58 °C, 10 s; 72 °C, 20 s. cDNA samples were amplified in triplicate using SensiMix SYBR green (Bioline) and primers specific for human and mouse PlGF, FOXO1, FOXO3A, VEGF and β-actin (Table S1). PCR products were analysed by 2% agarose gel electrophoresis, sequenced, and post-run melt curve analysis performed to ensure specificity of reactions. The mean threshold cycle (Ct) for each sample was normalised to β-actin levels and fold changes to the experimental control calculated using the ^ΔΔCt method.

qPCR was performed (using SensiMixTM SYBR® Green (Cat# QT650-05, Bioline) on a Roche LightCycler 480 (Roche Molecular Biochemical, Indianapolis, IN)³⁸ (link) using primers in (Table S1) and Actb was used as the internal control standard for all samples. 12 μL of reaction mix (7.5 μL of SensiMix™ SYBR No-ROX (1X) mixed with 250 nM forward and reverse primers and the final volume was made up with RNase-free water) and 3 μL of RNA sample was added to each well of a 384-well plate (Cat# 047297400, Roche). All samples were run in technical replicate (n = 3) along with standard curves prepared from a 5-fold dilution of the stock cDNA samples mixed and blanks. To assess mRNA transcript expression levels in the samples, the following program was used: 45 cycles at 95°C for 15 seconds, 60°C for 15 seconds and 72°C for 15 seconds. The melting curve was obtained by running the plate at 95°C for 5 seconds and a 58°C for 1 minute. The mRNA expression level was measured using the Advanced Relative Quantification relative to reference transcript (Actb) on Roche LightCycler 480 v 1.5 software.