Each sample (10 mg DW) was extracted using a vortex with 500 µL of methanol containing 8 μM of two reference compounds (methionine sulfone for the cation and camphor 10-sulfonic acid for the anion analyses), 500 μL of chloroform, and 200 μL of water. The extracted solution was centrifuged at 15,000 g for 3 min at 4 °C (MX-305, TOMY, Tokyo, Japan). The upper layer was evaporated for 30 min at 45 °C by a centrifugal concentrator (Thermo Fisher Scientific K.K., Tokyo, Japan) to obtain two layers. For removing high-molecular-weight compounds, such as oligo-sugars, the upper layer was centrifugally filtered through a PALL Nanosep 3-kDa cutoff filter at 9100 g for 90 min at 4 °C. The filtrate was dried for 120 min by a centrifugal concentrator. The residue was dissolved into 20 μL of water containing 200 μM of internal standards (3-aminopyrrolidine for cation and trimesic acid for anion analyses) that were used for the compensation of migration time in the peak annotation step.
Centrifugal concentrator
Manufactured by Thermo Fisher Scientific
Sourced in Japan
A centrifugal concentrator is a laboratory instrument used to concentrate liquid samples by removing solvents or other volatile components. It operates by applying centrifugal force to the sample, causing the less dense volatile components to separate from the more dense sample material. This process can be used to concentrate a variety of liquid samples, such as proteins, nucleic acids, or other biological or chemical substances.
Automatically generated - may contain errors
2 protocols using centrifugal concentrator
1
Metabolite Extraction and Purification for LC-MS
2
Recombinant Trout Interferon-Alpha Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA sequence encoding the mature peptide of trout IFNa was amplified from a poly IC stimulated cDNA sample using the primers IFNaF (TGTGACTGGATCCGACACCAT) and IFNaR (GTACATCTGTGCTGCAAGGATATCC). The amplified product was cloned to a pTriEx vector (Novagen) as described previously [45] . Sequence analysis of the construct used for recombinant protein production revealed that it encodes a His-tag (MAHHHHHHHHG) at the N-terminus followed by the 152 aa mature peptide identical to XP_021480273. Thus, the recombinant trout IFNa was 163 aa with a calculated molecular weight of 19.5 kDa and a theoretical pI of 9.17. A sequence confirmed plasmid was transformed into BL21 Star (DE3) competent cells (Invitrogen). The protein was produced, purified under denaturing conditions, refolded, and quantified as described previously [34, 43, 45] . The refolding buffer was phosphate buffered saline (PBS, pH7.4, Sigma, UK) containing 10% glycerol, 0.5 M arginine monohydrochloride, and 5 mM 2-mercaptoethanol (2-ME). The purified protein was buffer changed using a centrifugal concentrator (10 kDa cutoff, Thermo Scientific). The storage buffer was PBS (pH7.4) containing 10% glycerol, 2 mM EDTA, 10 mM
arginine monohydrochloride, 10 mM glutamine, and 5 mM 2-ME. After sterilization with a 0.2 µm filter, the recombinant protein was aliquoted and stored at -80 o C ready for bioactivity analysis.
arginine monohydrochloride, 10 mM glutamine, and 5 mM 2-ME. After sterilization with a 0.2 µm filter, the recombinant protein was aliquoted and stored at -80 o C ready for bioactivity analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!