Smz1500 stereomicroscope

GUS activity was localized in transgenic plants carrying the GH3:GUS construct. The staining protocol was adapted from Vitha et al. (1995) . The roots were first fixed with ice-cold fixative of 4% formaldehyde in phosphate buffer (pH 7) and subsequently washed three times within 60 minutes with ice-cold phosphate buffer. The X-gluc substrate solution (1mg 5-bromo-4-chloro-3-indolyl β-D-Glucuronide in 0.1mL methanol, 1mL phosphate buffer, 20 µL 0.1M potassium ferrocyanide, and 20 µL 0.1M potassium ferricyanide) was then vacuum infiltrated into the root tissue before overnight incubation at 37°C. The roots were then embedded in 3% DNA grade agarose and sectioned using a vibratome (1000 Plus; Vibratome Company). Staining was performed twice, each with six individual plants and observed using a Nikon SMZ1500 stereomicroscope (Nikon Inc., New York, USA).

From 1 to 7 dpf, any deceased embryos or larvae were removed from the culture dishes. We assessed the hatching rate—percentage of larvae that successfully hatched in relation to the total number of live animals in the batch—at 72 hpf. The evaluation of hatching and survival rates was conducted using a Nikon^® SMZ1500 stereomicroscope (Nikon, Tokyo, Japan).

Whole-mount ISH was performed as previously described (Thisse et al, 2004 ). The wdr31 cDNA with T7 promoter was PCR amplified, with forward primer: ATGGGGAAGCTACAGAGCAAGTTC and reverse primer: TAATACGACTCACTATAGAAGCGAGCCACTTCAGTGATACTG, from a homemade cDNA library of zebrafish embryos at 24 hpf. The antisense probe for wdr31 was then transcribed with digoxigenin-labeled UTPs and T7 RNA polymerases (Roche). The stained embryos were dehydrated in glycerol and photographed with a Nikon SMZ1500 stereomicroscope (Nikon).

Wood particles of WT and AtRGIL6‐expressing lines were sieved to select particles sized between 300 and 500 µm in length. Fifty mg of screened particles were fragmented in a 2‐mL micro‐centrifuge tube with three stainless steel beads using a Spex Certiprep 2000 Geno/Grinder (spexsampleprep.com) at 1500 oscillations per minute for 30 s. Homogenized wood particles were photographed with a Nikon SMZ1500 stereo microscope (nikoninstruments.com). Resulting particle sizes were analysed with a computer program, SmartGrain (Tanabata et al., 2012) set at ‘rough 3’ selectivity.

All animal studies were approved by the Institutional Animal Care and Use Committee of Shanghai Cancer Center, Fudan University. For tumorigenesis assays, 2 × 10⁶ MDA‐MB‐231 cells stably expressing pCDH and HA‐PSG9 and LM2‐4175 cells stably expressing shNC and shPSG9 were injected into the mammary fat pad of 6‐week‐old BALB/c female mice (n = 6; State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Shanghai, China). The mice were killed after 8 weeks of the inoculation, primary tumors were harvested, and tumor weight was determined. For experimental metastasis assays, 2 × 10⁶ MDA‐MB‐231 cells stably expressing pCDH and HA‐PSG9 as well as LM2‐4175 cells stably expressing shNC and shPSG9 in 200 μL of PBS were injected in the tail vein of 6‐week‐old BALB/c female nude mice (n = 6; State Key Laboratory of Oncogenes and Related Genes). After 6 weeks of injection, the lungs were excised, fixed in Bouin solution overnight, and lung colonies were counted under a Nikon SMZ1500 stereomicroscope (Nikon, Tokyo, Japan).