The total RNA of Aurantiochytrium sp. PKU#SW7 was extracted with RNAExTM total RNA isolation solution (Generay, Shanghai, China) according to the manufacturer’s guidelines. Briefly, samples were homogenized in 1 mL RNAExTM using a MP homogenizer (MP FastPrep®-24, Santa Ana, CA, USA). Then, 200 μL of chloroform was added and the mixtures were incubated for 2 min at room temperature. After centrifugation at 12,000 g for 10 min, the aqueous phase was transferred to a fresh tube, and 500 μL of isopropyl alcohol was added for RNA precipitation and recovery through centrifugation at 12,000 g for 10 min. Afterwards, 1 mL of 75% ethanol was added for RNA washing and the RNA pellet was dissolved in DEPC (diethyl pyrocarbonate) treated water. The integrity of RNA was detected by agarose gel electrophoresis and the concentration was estimated by a UV-Vis spectrophotometer Nanophotometer P300 (Implen, Munich, Germany) and Agilent 2100 bioanalyzer (Agilent, Santa Clara, CA, USA). RNA samples with OD260/280 ≥ 1.8, OD260/230 ≥ 1.8, and RIN > 9.5 were selected for cDNA library construction. Finally, the cDNA libraries were sequenced at Beijing Genomic Institute (BGI)-Shenzhen, China, using Illumina HiseqTM 2000 according to the manufacturer’s instructions (Illumina, San Diego, CA, USA).
Rnaex total rna isolation solution
Manufactured by Generay
Sourced in China
RnaExTM Total RNA Isolation Solution is a reagent designed for the extraction and purification of total RNA from various biological samples. It utilizes a guanidinium-based lysis buffer and a rapid silica-membrane based purification method to isolate high-quality, intact RNA from cells and tissues.
Automatically generated - may contain errors
Lab products found in correlation
Mp fastprep 24, by MP Biomedicals (1 mentions)
Hiseq 2000, by Illumina (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Nanophotometer p300, by Implen (1 mentions)
Iqtm sybr green supermix, by Bio-Rad (1 mentions)
Rayscript cdna synthesis kit, by Generay (1 mentions)
Reverse transcriptase, by Aidlab (1 mentions)
Abi prism 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Applied science lightcycler 480, by Roche (1 mentions)
Hiscript q rt supermix, by Vazyme (1 mentions)
M1701, by Promega (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
Transstart top green qrt pcr kit, by Transgene (1 mentions)
6 protocols using rnaex total rna isolation solution
1
Total RNA Extraction from Aurantiochytrium
2
Quantifying Survival Gene Expression in Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative expression levels of the survival-related hub genes were further identified in LNM− (n = 18) and LNM+ primary tumors (n = 18). Total RNA was isolated from collected tumor tissues using RnaExTM Total RNA Isolation Solution (GK3006, GENEray, Shanghai, China). Moreover, 1 μg of total RNA was used to synthesize cDNA. The quantitative real-time polymerase chain reaction (qRT‐PCR) was performed using 500 ng cDNA per 10 μl reaction. Each reaction was conducted with iQTM SYBR® Green Supermix (Bio‐Rad, Hercules, CA, USA). Gene amplification was conducted on thermal cycler programmed as follows: initial denaturation at 95°C for 5 min followed by 35 cycles at 95°C for 10 s, annealing at 60°C for 20 s, 72°C for 1 min, extending at 72°C for 5 min. Each sample was analyzed in triplicate. Relative expression levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative expression of targets in LNM+ tumors compared with LNM− tumors was calculated using 2−△△ct. The primer sequences are presented in Table 1
3
Influenza Virus Infection and Eleutheroside B1 Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The A549 cells were seeded in a 6-well plate at 37°C with 5% CO2, and then infected with influenza virus (PR8, 0.1 MOI). Following incubation for 2 h, the cells were treated with eleutheroside B1 (100 µg/ml). At 24 h post-infection, the cells were collected for the mRNA expression testing of selected genes [nuclear paraspeckle assembly transcript 1 (NEAT1) and L antigen family member 3 (LAGE3)] by RT-qPCR. The primer sequences of NEAT1 and LAGE3 are as presented in Table I . RNA was extracted with RnaExTM Total RNA Isolation Solution (GENEray, Inc.). The production of cDNA was then achieved using the Rayscript cDNA Synthesis kit (GENEray, Inc.) with 60 min at 37°C, and 5 min at 85°C. Subsequently, cDNA was used for qPCR using SYBR-Green Power qPCR PreMix (GENEray, Inc.). Primers of NEAT1 and LAGE3 were designed with Entrez Gene: 283131 and Entrez Gene: 8270. The thermocycling conditions were 1 cycle conditions including 10 min of initial denaturation at 95°C and 40 cycles of 10 sec denaturation at 95°C, 34 sec annealing at 60°C, 15 sec denaturation at 95°C, and 1 solubility curve cycle of 60 sec of annealing at 60°C, 30 sec annealing at 95°C, 15 sec annealing at 60°C. The method of quantification used was that of Livak and Schmittgen (2−ΔΔCq) (39 (link)).
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 3–5 inflorescence samples using RNaEXTM Total RNA Isolation Solution (Generay, China). cDNA was synthesized from 4μg total RNA using reverse transcriptase (Aidlab, China) and qRT-PCR analyses were performed on an ABI PRISM 7500 Real-Time PCR System (Applied Biosystems, USA). Each qRT-PCR experiment was performed in three biological replicates and three technical replicates. The ACTIN2 gene was used as an internal reference to normalize the expression data. Fold change was calculated using the 2-ΔΔCt method [60 (link)] and the standard deviation was calculated between three biological replicates, using the average of the three technical replicates for each biological sample. The gene-specific primers are listed in S1 Table .
5
Quantification of ITCH mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNaEXTM Total RNA Isolation Solution (Generay, China) according to the manufacturer’s protocol. cDNA was prepared using HiScript® Q RT SuperMix (Vazyme, China). Quantitative PCR was performed using AceQ® Green I (Vazyme, China) with a Roche Applied Science LightCyclerTM 480 (Roche, Swiss). The primers were as follows: ITCH (ITCH F, TTCGTGTGTGGAGTCACCAG; ITCH R, TGTCACCTCC AAGCTGCAAA). The relative mRNA level of ITCH was calculated by 2-ΔΔCT method and normalized with GAPDH as endogenous reference gene.
6
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from P. patens clones using RNaEXTM total RNA isolation solution (Generay). cDNA was synthesized using M-MLV reverse transcriptase (Promega M1701). cDNA was diluted fivefolds and then used for qRT-PCR. All reactions were carried out on ABI7500 (Life Technologies) using TransStart Top Green qRT-PCR kit (Transgen Biotech) with three independent biological replicates. Housekeeping gene ACTIN (XM_001775899) was used as control to calculate the relative gene expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!