Compound 4896-3212 (named neuradapt) was obtained from ChemDiv Research Institute (Khimki, Russia), adaptaquin and FG-4592 (roxadustat) were purchased from Cayman Chemical (Ann Arbor, MI, USA). Compound structures are shown in Figure 1 . HIF1 ODD-luc/SH-SY5Y cell-based reporter assay was performed as described in [14 (link)]. Drug aliquots were prepared in DMSO, and added to the reporter cell line as 2 μL aliquots. Luciferase activity was measured 3 h post-incubation with a drug. Experiments were performed in triplicate.
Fg 4592
Manufactured by Cayman Chemical
Sourced in United States, China
FG-4592 is a chemical compound produced by Cayman Chemical. It functions as a hypoxia-inducible factor (HIF) prolyl hydroxylase inhibitor. The core function of this product is to inhibit the HIF prolyl hydroxylase enzyme, which plays a role in the regulation of the HIF transcription factor pathway.
Automatically generated - may contain errors
Lab products found in correlation
1400w dihydrochloride, by Cayman Chemical (2 mentions)
Sodium pyruvate, by Fujifilm (1 mentions)
Interleukin 2 (il 2), by Merck Group (1 mentions)
Il 33, by Merck Group (1 mentions)
Interleukin 7 (il 7), by Merck Group (1 mentions)
Hepes koh, by Fujifilm (1 mentions)
Non essential amino acids (neaa), by Fujifilm (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Sh800s cell sorter, by Sony (1 mentions)
Apoptosis detection kit, by Transgene (1 mentions)
Pcr kit rr036a and rr420a, by Takara Bio (1 mentions)
Tlr4 antibody, by Proteintech (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
In situ cell death detection kit, by Roche (1 mentions)
Peroxidase conjugated goat anti mouse secondary antibody 31430, by Thermo Fisher Scientific (1 mentions)
Peroxidase conjugated goat anti rabbit secondary antibody 31460, by Thermo Fisher Scientific (1 mentions)
Rabbit anti cleaved caspase 3 9664, by Cell Signaling Technology (1 mentions)
Anti α tubulin, by Cell Signaling Technology (1 mentions)
10 protocols using fg 4592
1
Evaluation of HIF-1 Agonist Compounds
2
Isolation and Culture of Murine ILC2s
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Enriched kidney lymphocyte fractions were stained with anti-lineage cocktail (CD3ε, Ly-6G/Ly-6C (Gr-1), CD11b, CD45R (B220), Ter-119), anti-CD127 (IL-7Rα), anti-CD25 (IL-2Rα), anti-CD4, and anti-ST2 antibodies (Biolegend, San Diego, CA). Cells were sorted by SH800S cell sorter (SONY, Tokyo, Japan) with excluding dead cells by using 7-AAD. Gating strategy to sort ILC2s was lineage- CD127 + CD4- ST2 + CD25 + fraction (Supplementary Fig. 1 ), and the sorted ILC2 purity was routinely > 95%. These cells were cultured at 37 °C 5% CO2 in RPMI-1640 containing with 10% heat-inactivated FBS (Sigma, St. Louis, MO), penicillin/streptomycin, 50 μM 2-ME, 20 mM HEPES–KOH (pH7.53), 1 mM sodium pyruvate, 1 × non-essential amino acids (Wako). These cells were cultured with recombinant murine IL-2, IL-7, and IL-33 (each 10 ng/ml, Biolegend). To collect ILC2 supernatant, sorted ILC2s (1 × 105 cells/ml) were cultured for 3 days with IL-2, IL-7 and IL-33 in the presence or absence of DMSO, GSK360A (50 μM, Sigma) or FG-4592 (50 μM, Cayman chemicals, Ann Arbor, MI), and then collected supernatant filtered through 0.22-μm PVDF membrane.
3
In Vivo Tumor Growth Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LLC cells were maintained in Dulbecco’s Modified Eagle Medium containing 10% foetal bovine serum and penicillin/streptomycin in 5% CO2 and 95% room air at 37 °C.
These cells were harvested and re-suspended (at 1 × 107 cells/mL) in phosphate-buffered saline (PBS). Some of the cells (1 × 106 cells) were subcutaneously transplanted into the right flank of the mice which were aged at 8–12 weeks. The mice were treated with 400 mg/kg DMOG (Cayman Chemical, MI, USA) or 50 mg/kg FG4592 (Cayman Chemical, MI, USA) intraperitoneally 10 days after the tumour transplant. Once every two days, the tumours were measured in two dimensions using a calliper. The tumour tissue volume was calculated using the formula: V = π (length × width2)/6. The mice were sacrificed at a defined time point or when the tumour volume reached 4500 mm3.
These cells were harvested and re-suspended (at 1 × 107 cells/mL) in phosphate-buffered saline (PBS). Some of the cells (1 × 106 cells) were subcutaneously transplanted into the right flank of the mice which were aged at 8–12 weeks. The mice were treated with 400 mg/kg DMOG (Cayman Chemical, MI, USA) or 50 mg/kg FG4592 (Cayman Chemical, MI, USA) intraperitoneally 10 days after the tumour transplant. Once every two days, the tumours were measured in two dimensions using a calliper. The tumour tissue volume was calculated using the formula: V = π (length × width2)/6. The mice were sacrificed at a defined time point or when the tumour volume reached 4500 mm3.
4
Detailed Protocol for qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FG-4592 was purchased from Cayman Chemical Company (www.caymanchem.com ), and normal saline (NS) was obtained from Changhai Hospital (Shanghai, China). The apoptosis detection kit was purchased from TransGen (Beijing, China). The PCR kit (RR036A and RR420A) was purchased from TAKARA (Japan). RPMI 1640, DMEM and fetal bovine serum (FBS) were supplied by Gibco (New York, USA). Organoid cultures were obtained from STEM CELL. BCL2, BAX, C-CASPASE3, GAPDH, NF-κB and P-IKK-β antibodies were supplied by CST. The TLR4 antibody was supplied by Proteintech. In Situ Cell Death Detection Kit was obtained from Roche (Basel, Switzerland). The primes were obtained from Shenggong Biotech (Shanghai, China). The list of primers is shown in Table 1 .
qRT-PCR primers for the eight genes evaluated
| Gene symbol | Forward | Reverse |
|---|---|---|
| TLR4 | AAATGCACTGAGCTTTAGTGGT | TGGCACTCATAATGATGGCAC |
| IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
| IGFBP2 | CAGACGCTACGCTGCTATCC | CCCTCAGAGTGGTCGTCATCA |
| SOX2 | GCGGAGTGGAAACTTTTGTCC | CGGGAAGCGTGTACTTATCCTT |
| REG2 | CTGATGTTCCTGTCATACAGCC | CCAGGTCAAACGGTCTTCAATTA |
| REG3B | ACTCCCTGAAGAATATACCCTCC | CGCTATTGAGCACAGATACGAG |
| REG3D | GACTCCATGATCTGTCACTTGG | CATAGGGAAATGTTGGGTCACAA |
| HK1 | CAAGAAATTACCCGTGGGATTCA | CAATGTTAGCGTCATAGTCCCC |
5
Roxadustat Oral Dosing in C57BL/6J Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult female C57BL/6J mice were treated p.o. with vehicle or 600 mg/kg b.w. (body weight) roxadustat (FG-4592, Cayman, #15294), dissolved in 5% DMSO mixed into nut nougat cream, for 8 h. All animals were housed in cages under environment-controlled conditions with a constant 12 h/12 h light/dark cycle, ambient temperature, 40-60% relative humidity, and access to food and water ad libitum. All animal experimental procedures were approved by the local animal welfare authorities (LaGeSo: G0133/18) and followed institutional as well as ARRIVE guidelines.
6
Signaling Pathway Molecular Markers
7
Modulation of CD8+ T cell function
8
Optimizing Macrophage iNOS Expression via FG4592
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For optimization, BMDMs were treated with 100, 50, 25, 12.5, 0 μM FG4592 (HIF prolyl-hydroxylase inhibitor) or hypoxia for 24 hours before collected for transcriptional analysis of iNOS expression using Qiagen RNeasy Kit (cat nr: 74106). cDNA was produced with iScript cDNA Synthesis Kit (1708890, Bio Rad) followed by realtime analysis using KiCqStart SYBR Green predesigned primers (KSPQ12012, Sigma-Aldrich) for Nos2 (GeneID: 18126) and Hprt (GeneID: 15452). The optimal dose of FG4592 was selected by choosing the concentration of FG4592 that induces the same level of Nos2 expression as hypoxia. The antigen presenting assay was performed as described above with either 12,5 μM FG4592 (15294, Cayman Chemical), 12,5 μM DMOG (71210 Cayman Chemical) or Dimethyl sulfoxide (D8418, Sigma-Aldrich) as a solvent control.
9
Modulating T-cell Metabolism and Function
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each treatment, the same batch of cells was either incubated for 3 days with IL2 supplemented T-cell media containing the experimental compound or DMSO vehicle control (<0.1% of total well volume to avoid unspecific toxicity). The prolyl hydroxylase inhibitor FG-4592 (Cayman Chemicals) was used at 50 μmol/L in wild-type (WT) mouse CD8+ T cells cultured in 1% O2. The NOS2 inhibitor 1400W dihydrochloride (Cayman Chemicals) was used at 100 μmol/L in mouse CD8+ T cells transduced with VC or NOS2OE vectors following enrichment of Thy-1.1+ cells using MACS as described below. Human CD8+ T cells were treated with the NO donor compound 2,2′-(Hydroxynitrosohydrazino) bis-ethanamine (NOC-18; Cayman Chemicals) or with the panNOS inhibitor N(gamma)-nitro-L-arginine methyl ester (L-NAME; Cayman Chemicals) at concentrations ranging from 1 to 256 μmol/L. T cells treated with the different compounds were then analyzed as detailed in figure legends.
10
Cell Viability Assay for N2a and α-Syn-N2a Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
N2a cells and α-Syn-N2a cells were seeded at 5 × 104 cells/mL in 24-well plates in DMEM comprising 10% FBS. The number of live cells was estimated utilizing a Cell Counting Kit-8 according to the manufacturer’s protocol (Wako Pure Chemical Industries Ltd.) as previously stated12 (link). N2a cells were treated with 10, 20, 30, 50, and 100 µM FG-4592 (Cayman CHEMICAL). α-Syn-N2a cells were treated with 50 µg/mL of cumate in the presence or absence of 10, 30, or 50 µM FG-4592 and 3 µM Zinc protoporphyrin for 48 or 72 h. The number of live cells was projected by the Cell Counting Kit-8, following the manufacturer’s instructions (Wako Pure Chemical Industries Ltd.). Briefly, the reagent was included in the wells and the plate was incubated at 37 °C for 2 h. Cell viability was computed through the detection of the optical density of formazan at 450 nm utilizing Varioskan LUX (Thermo Fisher Scientific). A 600 nm wavelength was employed as a reference.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!