Itaq sybr green supermix with rox

Manufactured by Bio-Rad

Sourced in United States, Canada

The ITaq SYBR Green Supermix with ROX is a ready-to-use qPCR master mix designed for real-time PCR applications. It contains the necessary components for efficient amplification, including the ITaq DNA polymerase, SYBR Green I dye, and ROX passive reference dye.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SYBR Green Supermix (1501 citations) SYBR Green (1276 citations) ITaq SYBR Green (82 citations) ITaq Supermix (28 citations) ITaq Fast SYBR Green Supermix with ROX (15 citations) ITaq Supermix with ROX (13 citations) SYBR Green Supermix with ROX (11 citations) ITaq SYBR Green Supermix with Rox dye (7 citations) ITaq Universal SYBR Green Supermix with ROX (4 citations) ITaq SYBR Green Supermix with ROX kit (4 citations)

118 protocols using itaq sybr green supermix with rox

Quantifying Granzyme B Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from treated cells using an RNeasy Mini kit (Qiagen) following the manufacturer's instructions. Reverse transcription was performed using the First strand cDNA synthesis Kit (Fermentase Life Science Co.). cDNAs were amplified by real-time PCR using iTaqTM SYBR Green Supermix with ROX (Bio-RAd). Primer sequences were:
Samples were run in triplicate in a 96 well Optical Reaction plate (Applied BioSystems). The PCR reaction conditions were: 50°C for 2 min, 95°C for 5 min, 35 cycles of 95°C for 30 s, 59°C for 1 min, 72°C for 1 min, followed by dissociation step. Granzyme B RT-PCR analysis was performed by using Taqman primers Mm00442837_m1 and GAPDH: Mm99999915_g1 as housekeeping gene (Applied Biosystems). Results were analyzed using the 7,300 system Software (Applied BioSystems).

Sorrentino C., Hossain F., Rodriguez P.C., Sierra R.A., Pannuti A., Hatfield S., Osborne B.A., Minter L.M., Miele L, & Morello S. (2019). Adenosine A2A Receptor Stimulation Inhibits TCR-Induced Notch1 Activation in CD8+T-Cells. Frontiers in Immunology, 10, 162.

+ Open protocol

+ Expand

Quantitative PCR Analysis of HIF-1 and LMP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA purification and the reverse transcription process have been previously described [46 (link)]. Quantitative PCR was performed with iTaq^TM SYBR Green Supermix with ROX (172-5850, Bio-Rad) using an ABI 7500 instrument. The primers used to detect HIF-1 were: 5′-CGTTCCTTCGATCAGTTGTC-3′ (forward) and 5′-TCAGTGGTGGCAGTGGTAGT-3′ (reverse); LMP1 were: 5′-CGTTATGAGTGACTGGACTGGA-3′ (forward) and 5′-TGAACAGCACAATTCCAAGG-3′ (reverse). Primers for detecting β-actin were 5′-CATGTACGTTGCTATCCAGGC-3′ (forward) and 5′-CTCCTTAATG TCACGCACGAT-3′ (reverse).

Yang L., Liu L., Xu Z., Liao W., Feng D., Dong X., Xu S., Xiao L., Lu J., Luo X., Tang M., Bode A.M., Dong Z., Sun L, & Cao Y. (2015). EBV-LMP1 targeted DNAzyme enhances radiosensitivity by inhibiting tumor angiogenesis via the JNKs/HIF-1 pathway in nasopharyngeal carcinoma. Oncotarget, 6(8), 5804-5817.

+ Open protocol

+ Expand

LMP1 Gene Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained and performed reverse transcription as described before.19 Quantitative PCR was performed with iTaq^TM SYBR Green Supermix with ROX (172‐5850, Bio‐Rad) using an ABI 7500 instrument. The primers used to detect LMP1 were 5′‐CGTTATGAGTGACTGGACTGGA‐3′ (forward) and 5′‐TGAACAGCACAATTCCAAGG‐3′ (reverse). The primers for detecting β‐actin were 5′‐CATGTACGTTGCTATCCAGGC‐3′ (forward) and 5′‐CTCCTTAATGTCACGCACGAT‐3′ (reverse).

Zhang Z., Yu X., Zhou Z., Li B., Peng J., Wu X., Luo X, & Yang L. (2019). LMP1‐positive extracellular vesicles promote radioresistance in nasopharyngeal carcinoma cells through P38 MAPK signaling. Cancer Medicine, 8(13), 6082-6094.

+ Open protocol

+ Expand

Quantification of GM-CSF Secretion

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs, isolated by TRIZOL^®, were converted to cDNAs using 5× iScript^TM cDNA Synthesis kit (Bio‐Rad, Hercules, CA) as before.19 Primers for various genes used in cDNA amplification are listed in Table 1. PCR amplification was done in the presence of iTaq^TMSYBR^®Green Supermix with ROX (Bio‐Rad) using a CFX384 Touch^TM Real‐time PCR detection system (Bio‐Rad).
For ELISA, GM‐CSF secreted in the cell culture media was quantified using a human GM‐CSF Quantikine ELISA kit (cat # DGM00, R&D Systems, Minneapolis, MN). Cells (±IR) were cultured for 9 days and media collected on day 9 was used for ELISA. Quantification was done on four biological replicates, with each sample assayed in triplicate. ELISA on a microplate reader was done using vendor‐instructed conditions.

Jiang S., Song C.S, & Chatterjee B. (2019). Stimulation of prostate cells by the senescence phenotype of epithelial and stromal cells: Implication for benign prostate hyperplasia. FASEB bioAdvances, 1(6), 353-363.

+ Open protocol

+ Expand

Quantitative Analysis of Mitochondrial DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mitochondrial genome copy number was determined by real-time quantitative PCR as described previously (Bonnen et al., 2013 (link)). Briefly, the mitochondrial genome copy number is determined relative to the nuclear genome using the MTND1 region of mitochondrial genome and B2M as the nuclear genome normalizer. The assay utilized iTaqTM SYBR Green Supermix with ROX (Bio-Rad Laboratories, Hercules, CA) and was conducted in triplicate on total genomic DNA and shown as the average and standard deviation.

Besse A., Wu P., Bruni F., Donti T., Graham B.H., Craigen W.J., McFarland R., Moretti P., Lalani S., Scott K.L., Taylor R.W, & Bonnen P.E. (2015). The GABA transaminase, ABAT, is essential for mitochondrial nucleoside metabolism. Cell metabolism, 21(3), 417-427.

+ Open protocol

+ Expand

MDR1 Gene Expression in Caco-2 and LS-180 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Caco-2 or LS-180 cells were grown on Transwell^® inserts, 4.71 cm² for 7 (Caco-2) and 6 (LS-180) days. The cells were exposed to E1, E2, levothyroxine or rifampin for 24 h and 48 h. Total RNA was isolated by adding 1 mL Trizol^® reagent (Gibco-BRL, Carlsbad, CA, USA) to the cells and processed according to the manufacturer’s instructions. The concentration and purity of isolated RNA samples were measured using Quant-iT^TM RiboGreen^® RNA assay kit (Invitrogen, Eugene, OR, USA). The RNA sample (0.06 µg) was reverse transcribed by an iScript^TM cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). Relative quantification of gene expression was performed by iTaq^TM SYBR^® Green supermix with ROX (Bio-Rad Laboratories) using an ABI Prism 7500 Real Time PCR system (Applied Biosystems, Foster City, CA, USA). Each experiment was performed in duplicate and repeated for each condition tested. The mRNA levels of all genes were normalized using 18s as an internal control. Results are expressed as ratios of MDR1 to 18s expression.

Fan Y., Zhou Z, & Zhang L. (2024). Effect of Oregon grape root extracts on P-glycoprotein mediated transport in in vitro cell lines. Journal of Pharmacy & Pharmaceutical Sciences, 26, 11927.

+ Open protocol

+ Expand

Quantifying Skin-Draining LN Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from skin draining LNs was homogenized and extracted using TRIZOL® reagent (Invitrogen) and NucleoSpin® RNA II kit (Macherey-Nagel). First strand cDNA was synthesized using TaqMan® Reverse Transcription Reagents (Applied Biosystems). Real-time PCR were performed using iTaq^TM SYBR® Green supermix with ROX (Biorad) on a 7500 Real-Time PCR System (Applied Biosystems). Expression of genes of interest expression was normalized to the expression of GAPDH. The following primers were used: Sphk1, forward 5′-AACTTGACTGTCCATACCTGGTTC-3′ and reverse 5′-CACATACCATCAGCTCTCCATCC-3′; Sgpl1, forward, 5′-CCTGTTGGGCCGCCTTGATGC-3′ and reverse 5′-AAATTCCACCCCTTAGC-3′.

Tay M.H., Lim S.Y., Leong Y.F., Thiam C.H., Tan K.W., Torta F.T., Narayanaswamy P., Wenk M, & Angeli V. (2019). Halted Lymphocyte Egress via Efferent Lymph Contributes to Lymph Node Hypertrophy During Hypercholesterolemia. Frontiers in Immunology, 10, 575.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis of Cotton Fibers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from ovules at 0 DPA and fibers at 5, 10,15,20 and 25 DPA of Yumian 1 and RIL118. RNA degradation and contamination was monitored on 1 % agarose gels. First strand cDNA was synthesized from total RNA by priming with oligodT primer using Thermoscript Reverse Transcriptase (Invitrogen, Carlsbad, CA) at 50 °C. RT-PCR was carried out inareaction volume of 20 ml containing 10 ml iTaq^TM SYBR®Green Super mix with ROX (Bio-Rad Laboratories), 1 mM forward and reverse primers, and 0.1 mM cDNA template in a quantitative real-time PCR kit (Bio-Rad). PCR reactions were performed according to the manufacturer’s instructions. Cotton HISTONE3 (AF024716) was used as a loading control to normalize samples. Additional file 1 lists the primer sequences of the four candidate genes based on the Gossypium hirsutum L. reference genome [14 ].

Liu D., Zhang J., Liu X., Wang W., Liu D., Teng Z., Fang X., Tan Z., Tang S., Yang J., Zhong J, & Zhang Z. (2016). Fine mapping and RNA-Seq unravels candidate genes for a major QTL controlling multiple fiber quality traits at the T1 region in upland cotton. BMC Genomics, 17, 295.

+ Open protocol

+ Expand

Liver RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from livers using TRIzol Reagent (Life Technologies, Grand Island, NY) according to manufacturer's instructions. RNA was reverse-transcribed using SuperScript II RNase H^– Reverse Transcriptase (Life Technologies, Grand Island, NY). qRT-PCR assays using iTaqTM SYBR Green Supermix with ROX (Bio-Rad) were performed on an Applied Biosystems 7300 thermal cycler (Foster City, CA). Quantification was performed using the relative standard curve method. All measurements were performed in triplicate. PCR was performed with primers of cyclooxygenase-2 (COX2), GCTGTACAAGCAGTGGCAAA, GCTCGGCTTCCAGTATTGAG; inducible nitric oxide synthase (iNOS), GAGGCCGCATGAGCTTGGTGTTT, GGGGGTTGCATTTCGCTGTCTCC; and β-actin, GTGGGCCGCTCTAGGCACCA, TGGCCTTAGGGTTCAGGGGG.

Zhao Y., Zhou P., Liu B., Bambakidis T., Mazitschek R., Alam H.B, & Li Y. (2014). Protective Effect of SAHA against LPS-induced Liver Damage in Rodents. The Journal of surgical research, 194(2), 544-550.

+ Open protocol

+ Expand

Quantitative Analysis of CC16 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA preparation was performed using RNeasy Mini kit with DNAse treatment (from Qiagen GmbH, Hilden, Germany) and cDNA was synthesized using iScript TM cDNA Synthesis Kit from Bio-Rad Laboratories (Hercules, CA). The extracted RNA was quantified and checked using 260:230 nm absorbance spectra of a NanoDrop (Thermo Fisher Scientific, Rockford, IL), and cDNA from 29 ng RNA was used in each PCR reaction. Semi-quantitative real-time PCR was performed on an Applied Biosystem (Foster City, CA) 7900 thermocycler (95 C for 15 s, 60 C for 30 s and 74 C for 30 s, during 45 cycles) using iTaq TM SYBR Green Supermix with ROX from Bio-Rad Laboratories (Hercules, CA). Primers (from Invitrogen TM ), were used at 300 nM. The sequences (from 5 0 to 3 0 ) for the CC16 primers were; forward: CTT TCA GCG TGT CAT CGA AA and reverse: TGA TGC TTT CTC TGG GCT TT, Beta-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as housekeeping genes with primers as previously presented (Tufvesson et al. 2011) . The mean of the housekeeping genes was used as an internal standard, and the 2 DCt -model was used for quantification of CC16.

Stenberg H., Wadelius E., Moitra S., Åberg I., Ankerst J., Diamant Z., Bjermer L, & Tufvesson E. (2018). Club cell protein (CC16) in plasma, bronchial brushes, BAL and urine following an inhaled allergen challenge in allergic asthmatics. Biomarkers : biochemical indicators of exposure, response, and susceptibility to chemicals, 23(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!