Genelute bacterial dna kit

All isolates were serotyped. In addition, all serotype b isolates were leukotoxin promoter and AP-PCR genotyped. For the preparation of the PCR mixtures, PureTaq Ready-To-Go PCR (GE Healthcare; Little Chalfont, UK) was used. For serotyping and leukotoxin promoter typing, DNA was isolated by heating suspensions of the isolates in water for 8 min, while for the AP-PCR, the DNA was purified with GenElute Bacterial DNA kit (Sigma–Aldrich, St. Louis, MO).
The primers used and the PCR program for the serotyping and leukotoxin promoter typing are described elsewhere [29 (link)–31 (link)]. For the AP-PCR genotyping, the random sequence oligonucleotide OPB-3 (AGTCAGCCAC; Invitrogen, Carlsbad, CA; 0.4 µM) was used. The concentration of MgCl₂ in the PCR mixture was increased to 2.5 µM. The amplification was carried out as previously described [32 (link)].
The sequencing of the house-keeping gene, hbpA-2, was carried out as described elsewhere [18 (link)].

Approximately 100 ng of purified pMHM199 were added to 50 µl of electrocompetent cells prepared from MHM21 strain. The cells were electroporated in 0.2 cm gap cuvettes with a MicroPulser (BioRad). Cells were resuspended in 1 ml of SOB medium and recovered for 1 h at 30 °C. The cells were divided in 350 µl aliquots and plated onto LB agar with 100 µg/ml ampicillin and supplemented with 0, 125 or 500 ng/ml AHT. The plates were incubated at 30 °C overnight. After the incubation, 50 colonies from each treatment were patched onto a new LB agar 100 µg/ml ampicillin plate and incubated at 30 °C overnight to purify the colonies and ensure that only bacteria carrying pMHM199 were present. The colonies were transferred to a new LB agar 20 µg/ml chloramphenicol plate and incubated at 37 °C overnight. The colonies that grew showing chloramphenicol resistance were defined as carrying pLST and the colonies that were chloramphenicol sensitive were defined as cured from pLST. To confirm the curing of pLST, the DNA from three chloramphenicol sensitive colonies and MHM21 as control were extracted using GenElute Bacterial DNA kit (Sigma-Aldrich) for a PCR targeting the plasmid genes repA (MHM1 GGCTATAGAGTGCGGTCTGG and MHM2 TCCGTGCAGTTTACGTTCAG, spvA (MHM29 and MHM30) and the chromosomal gene phoN (MHM7 TCATTTGCTGTGGCCAGTT and MHM8 TTATTGCCTGATCCGGAGTG) as a control.

DNA isolation was performed after 24 h incubation in Brain-Heart-Infusion (BHI) medium at 37°C using the GenElute Bacterial DNA Kit supplied by SIGMA-ALDRICH (Darmstadt, Germany) following the manufacturer's instructions. A Nanodrop ND-1000 UV/Vis spectrophotometer (NanoDrop Technologies, Wilmington, DE) was used to determine the concentration of nucleic acids in the extractions.

Overnight cultures were prepared by inoculating a single colony from each strain into a 5 ml TSB and incubated at 37 °C, 120 rpm for 16–18 h. The desired strains were then diluted 1:50 in 13 ml of fresh TSB and grown to exponential phase (OD₅₄₀~0.15–0.20) to collect samples before induction. Next, the cultures were treated with MitC (2 μg ml⁻¹) and incubated at 30 °C and 80 rpm for 60 min prior to sample collection. One ml samples were collected, and genomic DNA was extracted using the GenElute Bacterial DNA kit (Sigma Aldrich) according to the manufacturer’s instructions. The DNA was precipitated by adding 10% (v/v) 3 M sodium acetate (pH 5.2), 2.5 volumes of 100% ethanol and incubation of the mixture for 1 h at −80 °C. The DNA was then pelleted at 16873 × g for 30 min at 4 °C and washed once with 1 ml of ice-cold 70% (v/v) ethanol. After centrifugation, the DNA pellets were air-dried for 30 min and re-suspended in 25 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Quality control of DNA samples was tested using Agilent Bioanalyzer 2100 and whole genome sequencing (WGS) was performed at the University of Glasgow’s Polyomics Facility using Illumina TruSeq DNA Nano library prep, obtaining 2 × 75 bp pair end reads with DNA PCR free libraries.