Sigenome non targeting sirna 2

TRAF6 protein was depleted from BMDMs with synthetic small interference RNAs (siRNAs) targeting mouse Traf6 (Dharmacon, Individual #1 J-042735-09, Individual #2 J-042735-10). siGENOME Non-Targeting siRNA #2 (Dharmacon, D-001210-02) was used for a negative control. Five million cells were transfected with each 30 nM siRNA using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer’s instructions with modifications as follows. Lipofectamine/siRNA complexes (240 pmol of siRNA plus 24 µL of Lipofectamine reagent) were formed in Opti-MEM (Thermo Fisher Scientific) for 15 min at room temperature and then added into cells and incubated for 5 min at room temperature. The cell mixtures were seeded in 10-cm tissue culture plates and cultured in RPMI 1640 containing 10% FBS, 1% penicillin/streptomycin+L-glutamine, and 16.7 ng/mL M-CSF. At 2 d after the siRNA transfection, serum starvation was performed in RPMI 1640 containing 1% FBS and 1% penicillin/streptomycin+L-glutamine for 12 h followed by stimulation of 100 ng/mL KLA or 50 ng/mL RANKL.

HeLa S3 cells were transfected with 10 nM siRNA pool (Human siGENOME SMARTpool, GE Dharmacon), which contains four oligos against each gene, using Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific). As negative controls, siGENOME Non-Targeting siRNA #2 (GE Dharmacon) and Select Negative Control No. 2 siRNA (Ambion) were used. Three different siRNAs against ATP1A1 (#1, s1718; #2, s1719; and #3, s1720) and two different siRNAs against ATP1A3 (#1, s1724; and #2, s1725) were purchased from Ambion. After 48 h, transfected cells were split and seeded in 96-well plates, and then treated with the indicated concentrations of etoposide or aurilide B for 48 h.

C33a cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing high glucose and l-glutamine and supplemented with 10% fetal bovine serum (FBS) (Sigma). Transfections were carried out with XtremeGene HP (Roche) at a DNA/reagent ratio of 2:1. Cells were synchronized by a double thymidine block, and synchrony was confirmed following fixation of cells in 70% ethanol before incubation with propidium iodide and RNase A and analysis by flow cytometry as previously described (18 (link)). For siRNA-mediated depletion experiments, cells were first transfected with siRNA duplexes by electroporation using an Amaxa system. A total of 4 × 10⁶ cells were resuspended in 100 μl electroporation solution (Mirus), and cells were pipetted into a 0.2-cm electroporation cuvette containing 20 μl of 20 μM ChlR1-specific siRNA targeting the 3′ UTR of ChlR1 (target sequence, 5′-AGUCACUCCUUCAGUAGAAUU-3′) or a nontargeting scramble control (siGENOME nontargeting siRNA 2; Dharmacon). Cells were electroporated using program S-005, immediately plated into a 10-cm-diameter dish, and allowed to recover overnight before transfection with E2-expressing plasmid DNA by use of XtremeGene as detailed above.

siRNA mediated down regulation of MITF and USF1 was achieved with the MITF specific sequence 5'-GGUGAAUCGGAUCAUCAAG-d(TT)-3' and 5'-CUUGAUGAUCCGAUUCACC-d(TT)-3' and with the USF1 specific sequence 5'-UGGAAGAUCUCAAGAACAA-d(TT)-3' and 5'-UUGUUCUUGAGAUCUUCCA-d(TT)-3'. Scrambled siRNA (siGENOMEnontargetingsiRNA 2) were purchased from Dharmacon (Chicago, IL, USA) and used as a control.

All the cell culture reagents were obtained from Invitrogen Corporation/ThermoFisher Scientific (CA, USA) unless otherwise stated. The Calu-3 bronchial epithelial cell line was obtained from the American Tissue Type Culture Collection (ATCC) and used at passages 20–40. All the poly (ethylene glycol) molecules were obtained from Iris Biotech (Marktredwitz, Germany). The siRNA sequences for human GAPDH, β-actin and IL-8 were obtained from Qiagen UK and were diluted 1:10 in TE buffer as directed. The specific sequences remained the proprietary knowledge of Qiagen. The siRNA sequences for rat CXCL-1 (5′ UAACGAGAUAUUUAACGCCCCC 3′) were obtained from (Riboxx GmbH, Radebeul, Germany), and the siGENOME non-targeting siRNA #2 (5′ UAAGGCUAUGAAGAGAUAC 3′) scrambled sequence controls were obtained from Dharmacon (now Horizon Discovery, Cambridge, UK). All the other general chemicals and reagents used were of the highest grade possible and were obtained from Sigma-Aldrich Company Ltd. (Wicklow, Ireland) unless otherwise stated.