Qtower

Splenic NK cells were directly isolated by magnetic activated cell sorting (MACS) using an NK cell isolation kit (Miltenyi, Bergisch Gladbach, Germany). Thereafter, mRNA was isolated by using Dynabeads oligo (dT) (Invitrogen, Thermo Fisher Scientific Inc.) following manufacturer´s instructions. Synthesis of cDNA was performed by reverse transcriptase reaction according to the supplier's instruction as already described (Thermo Fisher Scientific Inc.) as already described^{72 (link)}. The mRNA concentrations of genes were measured by real-time polymerase chain reactions (qTower, Analytik Jena AG, Jena, Germany) using SYBR Green Fluorescein Mix (BioRad, München, Germany) and the specific primers (KiCq- Start Primers, Sigma Aldrich, Supplementary Table S3). For normalization of target gene values, the housekeeping gene peptidylprolyl isomerase A (Ppia) was used. The relative mRNA concentration was calculated using the ΔΔCt method and individual amplification efficiency for each primer, determined by a standard curve with different primer dilutions^{106 (link)}. The mRNA concentrations of genes were measured by realtime detection reverse transcriptase-PCR (iQ5, BioRad) using SYBR Green MIX (BioRad). For determination of mRNA concentration, a threshold cycle (Ct) was obtained from each amplification curve using the software qPCRsoft 3.4 (Analytik Jena AG).

For isolation of total RNA from kidney cortex, the NucleoSpin 8 RNA Kit (Macherey-Nagel, Düren, Germany) was used. Elimination of possible DNA contamination was performed with the RNase-Free DNase Set (Qiagen, Hilden, Germany), and 1 µg total RNA was reverse-transcripted into cDNA with the Reverse-Transcription System Promega (Promega, Madison, WI, USA). Determination of gene-expression levels was performed by semi-quantitative real-time PCR by use of the LightCycler-FastStart DNA Master SYBR Green 1 (Roche Diagnostics, Mannheim, Germany) and a thermocycler (qTower, Analytik Jena, Jena, Germany). PCRs were carried out with sense and antisense primers at a concentration of 0.25 µM each (purchased from TIB Molbiol, Berlin, Germany). Temperatures and sequences of all primer pairs are shown in Table 1. Hypoxanthine phospho-ribosyltransferase 1 (HPRT1) was used as the housekeeping gene. Relative expression ratio was quantified by the ΔΔCT method, and transcript levels were normalized to the mean value of the MORG1 wild-type non-diabetic control group.

The quantitative real-time polymerase chain reaction was used to quantify the mRNA expressions of brain GRIN1, GABARα1, SLC6A1, SLC1A2, HO-1, Nrf2, PI3K, AKT, NF-κB, IL-1β, TNF-α, and TLR-4. The total RNA was extracted from brain tissues utilizing a total RNA extraction kit (RNAsimple Total RNA Kit, Tiangen Biotech, Beijing, China, Cat. # 4992858) according to the manufacturer’s instructions. The iScript cDNA Synthesis Kit was used for reverse transcription (Bio-Rad, Hercules, CA, USA, Cat. # 1708891). The cDNA obtained was amplified with a real-time PCR system (qTOWER, Analytik Jena GmbH, Jena, Germany), with the thermal cycling conditions as follows, the initial denaturation and enzyme activation at 95 °C for 3 min (1 cycle), and denaturation at 95 °C for 15 s (sec), annealing at 55 °C for 30 s, and extension at 72 °C for 30 s (40 cycles) using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA, Cat. # 1708880). The melting curve was performed after the cycle to ensure no non-specific products were present (1 cycle). Relative mRNA expression was normalized to β-actin or GADPH as an internal control to standardize the difference, and the primers’ sequences are shown in Table 3.

RNA was extracted according to TRI reagent manufacturer's instructions. When indicated, DNase treatment was performed according to instructions for Turbo DNase (Thermo Fisher Scientific) and a phenol/chloroform extraction performed. Either GoTaq 1-Step RT-qPCR System (Promega) was used or reverse transcription for mRNAs was performed using Superscript IV RT (Thermo Fisher Scientific) and oligo(dT) (Thermo Fisher Scientific) and qPCR using GoTaq qPCR Master Mix (Promega) on a qTower (Analytik Jena). Primers used for Influenza segment quantification are listed in Table 2.

For quantitative real time PCR at least five independent experiments were carried out. At first, RNA content was measured using Qubit RNA Assay Kit (Life technologies, Waltham, MA, USA). Quantitative real time PCR was performed using SensiFast TM SYBR/No-ROX One Step Kit (2 ng RNA; 10 pmol of each primer (Supplementary Table A); Bioline, Bochum, Germany) according to manufacturer’s protocol. β-Actin served as housekeeping gene. RNA reverse transcription, amplification and quantification was operated using qTower (Analytik Jena AG, Jena, Germany). For reverse transcription samples were heated up to 45 °C for 10 min followed by the activation of polymerase (95 °C, 2 min) and 40 cycles of denaturation (95 °C, 5 s), and annealing with elongation (varying temperature according to the primer, 20 s) in alternating order. Experiments were carried out in sets of three replicates, whose results were averaged and further mathematically processed using ΔΔ-CT method.

HL-60 cells were treated with 1,25(OH)₂D₃ for various time points, after which total RNA was extracted using QIAzol lysis reagent (Qiagen, Hilden, Germany). The purity and concentration of RNA samples were determined using a NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). 500 ng of total RNA were used to synthesize cDNA using ProtoScript^® II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), following the manufacturer’s instructions. Subsequently, qPCR was performed using the real-time thermal cycler qTower (Analytik Jena AG, Jena, Germany) to quantify mRNA levels. The following forward (for) and reverse (rev) primers (Eurofins Genomics, Ebersberg, Germany) were used: TXNIP for: 5′-CGCCTCCTGCTTGAAACTAAC-3′, rev: 5′-AATATACGCCGCTGGTTACACT-3′; CYP24A1 for: 5′-TGGGGCTGGGAGTAATACTGA-3′, rev: 5′-GAACGCAATTTCATGGGAGGC-3′; ITCH for: 5′-5TCTAGTAGCTGTGGTCGGGG-3′, rev: 5′-CACAAGGCCACCGTGAAATG-3′ and vinculin (as reference gene) for: 5′-CAGTCAGACCCTTACTCAGTG-3′, rev: 5′-CAGCCTCATCGAAGGTAAGGA-3′. Reactions were performed using ready to use master mix LightCycler^® 480 SYBR Green I (Roche, Mannheim, Germany).

Array-CGH experiments were performed by PartnerChip (Evry, France) using the Constitutional Chip 4.0 from Perkin Elmer. Reactions were performed using SYBR Green I PCR Master Mix (Applied Biosystems), which includes the internal reference (ROX). Each qPCR reaction comprised 12.5 μl 2× SYBR Green PCR Master Mix, forward and reverse primer at optimized concentrations of 800 nM (final concentration) and 400 nM (final concentration) for the reference primers (GAPDH: TCTTCATCACCACAGAGAACTTGC and GACCTGGAAGTCACTGGGCA), and 10 ng/μl genomic. DNA template and sterile water up to a final volume of 25 μl.
The qPCR reactions were performed using the qTower (AnalytikJena, Germany). qPCR data were obtained by using the qPCRsoft software (AnalytikJena, Germany). qPCR data was normalized adapting the method described by Weksberg et al. (2005)9 . Fold copy number (ΔKC_t) was obtained using the formulas: ΔKC_t = KC_t/control − KC_t/affected and KC_ti = (((AC_tR − C_tRi/S_R)) × S_T) + C_tTi where AC_tR is the average C_t value for the reference primer for all the samples, C_tRi is the C_t value for reference primer for the sample to be corrected, S_R is the slope value (from the standard curve) for the reference primer, S_T is the slope value for test primer, C_tTi is the C_t value for test primer.