To quantitatively determine the ratio of the G-to-T conversion rates, the primer extension products from DNA templates with different ratios of L-DNA-OG1/L-DNA-G by Bsu Pol were amplified by PCR and the PCR products were then ligated and cloned using pClone007 Blunt Simple Vector System (TSINGKE, Beijing, China) following the manufacturer's instructions. Individual clones were picked, lysed in TE buffer, amplified by PCR using M13 forward and reverse primers, and then sequenced using an ABI3700 (Applied Biosystems, Inc.). Forty positive clones per sample were picked and subjected to sequencing.
Abi3700
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The ABI3700 is a DNA sequencing instrument designed for high-throughput, automated DNA sequencing. It utilizes capillary electrophoresis technology to perform DNA sequence analysis. The core function of the ABI3700 is to generate DNA sequence data efficiently and accurately.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick reagents, by Qiagen (2 mentions)
Big dye v3.1 reagents, by Thermo Fisher Scientific (2 mentions)
Sequencher software v4, by Gene Codes (2 mentions)
Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Abi 3730xl, by Thermo Fisher Scientific (2 mentions)
Ceq 8000, by Beckman Coulter (1 mentions)
Multiplex master mix, by Qiagen (1 mentions)
M sssl methyltransferase, by New England Biolabs (1 mentions)
Abi prism bigdye terminator cycle sequencing ready reaction kit, by Thermo Fisher Scientific (1 mentions)
Megabace500, by GE Healthcare (1 mentions)
Abi 3100, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Real time pcr system, by Thermo Fisher Scientific (1 mentions)
Maxime rt premix kit, by iNtRON Biotechnology (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Sequencher software, by Gene Codes (1 mentions)
Taq polymerase, by Solgent (1 mentions)
Taq polymerase, by Qiagen (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
26 protocols using abi3700
1
Quantitative Analysis of G-to-T Conversion Rates
2
Microsatellite Analysis of Urogenital Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals that died of UGC were diagnosed at necropsy. Control animals were classed as having died, been euthanized or released after treatment due to a condition other than typical UGC. Genomic DNA (gDNA) was extracted following either a proteinase K-chelex DNA isolation method followed by phenol chloroform purification or using the PUREGENE DNA isolation method according to the manufacturer's instructions. Amplification of three microsatellite markers (Pv11, M11a and Hg8.10) was undertaken via a multiplex polymerase chain reaction (PCR) using Qiagen Multiplex Master Mix (Qiagen) and fluorescently tagged primers (AB, Life Technologies). This enabled fragment analysis via automated capillary electrophoresis (ABI3700, Applied Biosystems in study A or Beckman Coulter CEQ 8000, UK in study B) and subsequent allele identification. To check for errors in the amplification, a minimum of 10% of the samples were run in triplicate and two negative controls were included in each plate.
3
Methylation Analysis of Tumor Suppressor Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation of CpG rich 5′ regions in CDKN2A, CDKN2B and RASSF1A genes were assessed by BSP using bisulfite sequencing primers designed by online program MethPrimer (http://www.urogene.org/methprimer/index1.html ). For CDKN2A, forward primer 5′-TTTTTGAAAATTAAGGGTTGAGGGG-3′ and reverse primer 5′-AAAAAAACTAAACTCCTCCCCACCTAC-3′; for CDKN2B forward primer 5′-TTTATTGGGGATTAGGAGTTGAG-3′ and reverse primer 5′-CTAACAAAATAAAAAACCAACC-3′ and for RASSF1A forward primer 5′-GGGTTTTATAGTTTTTGTATTTAGGTTTTT-3′ and reverse primer 5′-AACTCAATAAACTCAAACTCCCCC-3′ were used for amplifying specific promoter region. Initial denaturation was performed at 95 °C for 1 minutes, followed by 40 cycles of PCR amplification (95 °C for 30 seconds, 60 °C for 30 seconds, and 72 °C for 45 seconds), and the final step was extended to 7 minutes at 72 °C for all three genes. Completely methylated by M.Sssl methyltransferase (New England Biolabs, USA) genomic DNA from a healthy individual was used as the positive control for methylation. After PCR, products were separated electrophoretically in 2% agarose gel and finally the amplified products were sequenced (ABI 3700, Applied Biosystems, USA). Sequencing data were further analysed for quantitation of percent methylation in promoter region by using BISMA (Bisulfite sequencing and DNA Methylation analysis) program32 (link).
4
Bacterial 16S rRNA Gene Amplification and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total community DNA was extracted from 0.25 g of sediment with an PowerSoilTM DNA Isolation Kit (MoBio, Karlsbad, CA) according to the manufaturer’s instructions. Bacterial 16S rRNA gene fragments (~1500 bp) were amplified using PCR with the universal primer pair 27F(AGA GTT TGA TCC TGG CTC AG) and 1492R(AAG GAG GTG ATC CAG CCG CA) (Massol-Deya et al., 1995 ). The steps in PCR include initial denaturation at 94 °C for 5 min and 30 cycles consisting of denaturation at 94 °C for 1 min, primer annealing at 55 °C for 1 min, and extension at 72 °C for 1 min. The final elongation step was extended to 10 min. The resulting 1.5 kb PCR product was purified and cloned into pCR2.1-TOPO cloning vector and transformed into OneShot®DH5™ TOP10 chemically competent Escherichia coli cells according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Randomly selected clones were sequenced using an ABI PRISM Big Dye Terminator Cycle-Sequencing Ready Reaction kit (PE-Applied Biosystems, Foster, CA) and an automatic sequence analyzer (ABI 3700).
5
BRCA1/2 Mutation Analysis in Cases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the participants’ peripheral blood samples. For BRCA1/2 mutation testing in cases, 22 coding exons of BRCA1 and 26 coding exons of BRCA2 were scanned through fluorescence-based conformation sensitive gel electrophoresis (F-CSGE) and denaturing high-performance liquid chromatography (DHPLC). For a subset of PCR products with aberrant patterns, direct sequencing was performed on an ABI3100 or ABI3700 (Applied Biosystems, CA) or a MegaBACE500 (GE Healthcare, UK) genetic analyzer. In this study, the definition of a genetic mutation is restricted to the protein-truncating mutation and the missense mutation, which are known to be associated with the disease. This study also includes the participants with a clinically unverified mutation in BRCA1/2 genes. More detailed information about BRCA1/2 mutation analysis has been described before31 (link),37 (link). Since this study also includes the cases with unverified mutation on BRCA1/2, we examined whether non-pathogenic variants on these genes are more frequent in the cases compared to controls at p-value of 0.05. And we searched them at the ClinVar database.
6
Quantification of RORC mRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using RNeasy Mini Kit (Qiagen, Hilden, Germany) and a spectrophotometer (Thermo Scientific, Waltham, MA, USA), total RNA was extracted from CD4+ T cells and analyzed to confirm their concentration and integrity. cDNA was synthesized with isolated RNA using Maxime RT premix kit (iNtRON Biotechnology, Seongnam, South Korea). qRT-PCR was then performed with SYBR Premix Ex Taq (Takara, Kusatsu, Japan), ABI 3700, and real-time PCR system (Applied Biosystems, Waltham, MA, USA). Quantification of relative mRNA expression was normalized to endogenous β-actin. Primers were used to quantify the transcripts of Rorc gene: forward TGCAAGACTCATCGACAAGGC and reverse AGCTTTTCCACATGTTGGCTG.
7
Primer-based PCR and Sequencing of CDH10 Gene
8
Verification of Fusion Gene Rearrangement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic rearrangement of the fusion gene was verified by PCR using a forward primer located in TSC2 (5′-CTCAGGTTCCGAGCCTAACAG-3′) and a reverse primer in RNF216 (5′-GCAAACATAGTGAGACCCCATCT-3′). The PCR reaction was performed as follows: 15 minutes at 94°C for initial denaturation, then 40 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute, with 5 minutes at 72°C for post-extension. For each reaction, 30 ng/μl gDNA, 100 nM primer, and 0.5 U of Taq polymerase (Qiagen) were used in a 20 μl reaction. The expression of a fusion gene in one patient sample was analyzed by RT-PCR using a forward primer located in TSC2 (5′-GAGCATGGCTCCTACAGGTACAC-3′) and a reverse primer in RNF216 (5′-CTCTTCACAGGTGAGGCCATTAT-3′). The RT-PCR reaction was performed as follows: 5 minutes at 94°C for initial denaturation, then 40 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute, with 5 minutes at 72°C for post-extension. For each reaction, 10 ng cDNA, 200 nM primer, and 0.5 U of Taq polymerase (Solgent, Korea) were used in each 20 μl reaction. The RT-PCR products were analyzed by Sanger sequencing using an automatic sequencer (ABI3700; Applied Biosystems) to verify their fusion at the sequence level.
9
Quantitative Transcriptome Analysis of Salicornia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of total RNA was reverse transcribed using M-MLV Reverse Transcriptase according to the manufacturer’s protocol (Promega, Madison, WI, USA). We selected 18 s rRNA and U6 snRNA as the endogenous controls. The primers for examined unigenes were designed by us from the S. aralocaspica transcriptome sequences and optimized for PCR (Additional file 24 : Table S21), and bulge-loop qRT-PCR primers for mature miRNAs and U6 were designed and provided by RIBOBIO (Guangzhou RIBOBIO Co., Ltd., Guangzhou, China). Real-time monitoring of PCR was performed with ABI3700 (Applied Biosystems, Grand Island, NY, USA) and TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China). Reaction was performed at 95 °C for 10 min, and then cycled at 95 °C for 15 s, 60 °C for 60 s for 40 cycles. Each assay was performed in triplicate, real-time qRT-PCR data were analyzed based on 2-ΔΔCt method [103 ].
10
Cloning and Characterization of HvCesA Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three PCW and two SCW CesA genes were individually cloned into the pMDC32 vector [47 (link)]. The forward and reverse primer pairs used to clone each full length gene are given in Table S1. Full length HvCesA1, HvCesA2, HvCesA4, HvCesA6 and HvCesA8 cDNAs were generated as described in Burton and co-authors [15 (link)] and were cloned into the pCR8®/GW/TOPO TA vector (Life Technologies, Australia). Clones from each construct were digested with restriction enzymes to select those with a sense orientation and were subsequently sequenced on an ABI 3700 (Applied Biosystems Inc., Australia) at the Australian Genome Research Facility (Adelaide, Australia) to verify the identity of genes and the precision of constructs. Each HvCesA cDNA was transferred (Life Technologies, Australia) into a Gateway-enabled constitutive expression vector, pMDC32 [48 (link)], carrying dual 35S promoters and a NOS terminator that flank the inserted CesA cDNA at the 5′ and 3′ ends of the gene, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!