Isogen kit

Vs, Hs and Vn were purchased from Sigma Aldrich, USA. Dulbecco’s Modified Eagle Medium (DMEM)/F-12 and Opti-MEM were obtained from Gibco, USA. Fetal bovine serum was from Gibco, South America. Penicillin - Streptomycin were purchased from Biowhittaker, USA. Non-essential amino acids were from Cosmo Bio Co, LTD, Japan. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) and dexamethasone were from Dojindo, Japan. Bupropion was from Wako, Japan. ATP bioluminescence kit was from TOYO Ink, Japan. ISOGEN kit was purchased from Nippon Gene, Japan. RIPA lysis buffer was from (Santa Cruz Biotechnology, USA). 2-D Quant was purchased from GE Healthcare Life Sciences, USA. Calcium Kit II-Fluo 4 was from Dojindo, Japan.

Adipose tissue was collected and incubated with 0.5% collagenase A (Roche, Mannheim, Germany) for 1 h at 37 °C. The digested adipose tissue was filtered through a 70‐μm strainer and centrifuged at 300 g for 4 min at 4 °C. The cell pellet was collected and washed with phosphate‐buffered saline. Total RNA was collected using an Isogen kit (Nippon gene, 311‐02501). cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen Valencia, CA, USA). The mRNA levels of Mafb, AIM, and Mac‐1 were measured using SYBR green PCR master mix (Takara Bio, Otsu, Japan). The mRNA levels of Mafb and AIM were normalized to the Mac‐1 mRNA level. The following primer sequences were used: Mafb forward, 5′‐TGAATTTGCTGGCACTGCTG‐3′; Mafb reverse, 5′‐AAGCACCATGCGGTTCATACA‐3′;AIM forward, 5′‐GTACCACGACTGTACCCACAAGGA‐3′;AIM reverse, 5′‐GAATGAGGGCCCACTGAACAA‐3′; Mac‐1forward, 5′‐ATGGACGCTGATGGCAATACC‐3′; Mac‐1 reverse, 5′‐ TCCCCATTCACGTCTCCCA‐3′;

Female individuals in short or long strains were frozen by liquid nitrogen. Head and thoracic tissues without legs were removed from the frozen bodies by a pair of fine spring scissors. Each tissue was homogenized by the scissors and an electric homogenizer (T10 + S10N-5G, IKA Works, Staufen, Germany) in an extraction buffer from an ISOGEN kit (Nippongene, Tokyo, Japan) according to the manufacturer’s instructions. The quality and quantity of the extracted DNA were determined at 230, 260, and 280 nm using a spectrophotometer (NanodropTM 2000, Thermo Fisher Scientific, MA, USA).

Frozen brains were dissected in ice-cold double-sterilized 0.1 M phosphate buffer (pH 7.0) on a Peltier cooling unit at approximately 4 °C covered with plastic paraffin film (Parafilm, Bemis Company, Chicago, IL, USA) under a dissecting microscope. Dissected brains, including the subesophageal ganglion, were homogenized with an electric homogenizer (T10 + S10N-5G, IKA Works, Staufen, Germany) in extraction buffer from an ISOGEN kit (NipponGene, Tokyo, Japan). Total RNA was extracted from two brains using an RNA isolation kit according to the manufacturer’s instructions. During RNA extraction, the RNA was treated with rDNase (RT Grade for Heat Stop, Nippongene) for 15 min to remove genomic DNA and then mixed with stop solution at 70 °C for 10 min. The quality and quantity of extracted RNA were determined at 230, 260, and 280 nm using a microvolume spectrophotometer (Nanodrop 2000, Thermo-Fisher Scientific, Waltham, MA, USA). Five RNA samples of queens and workers (two samples from each of two colonies and one sample from one colony) were examined.

According to the manufacturer’s guide, the RNA was extracted using the Isogen kit (Nippon Gene Co. Ltd., Tokyo, Japan). Then, RNA quantity and quality were determined using the NanoDrop 2000 spectrophotometer (ThermoScientific, Waltham, MA, USA).

Total RNA was isolated with a phenol-chloroform extraction method using ISOGEN kit (Nippon Gene Co., Ltd.) according to the manufacturer’s protocol, and reverse transcribed using QuantiTect^® Reverse Transcription Kit (QIAGEN). cDNA from 1 µg of total RNA was subjected to real-time PCR. TaqMan Gene Expression Master Mix (Life Technologies Co., Ltd.) was used for real-time quantitative PCR. The primer sets were obtained from Applied Biosystems (Fgf23, no. Mm00445621_m1; Actb, no. Mm02619580_g1). Reactions were run on and analyzed with a QuantStudio™ 5 real-time PCR system (Thermo Fisher Scientific K.K.). Fgf23 mRNA expression levels were normalized with respect to those of Actb mRNA.