Log In Sign up
The largest database of trusted experimental protocols

Chip assay kit

Manufactured by Abcam
Visit Supplier
Sourced in United Kingdom

The ChIP assay kit is a tool used to study protein-DNA interactions within a cellular environment. It allows for the isolation and identification of DNA sequences that are bound by specific proteins of interest.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green fluorescent dye, by Thermo Fisher Scientific (7 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions) Ab172730, by Abcam (3 mentions) Nuclear extraction kit, by Active Motif (3 mentions) Nonspecific igg antibodies, by Merck Group (2 mentions) Non specific igg, by Merck Group (2 mentions) Pparα, by Abcam (1 mentions) Nicd antibody, by Cell Signaling Technology (1 mentions) Ab32358, by Abcam (1 mentions) Ab137872, by Abcam (1 mentions) Mouse igg, by Merck Group (1 mentions) Hoxa5, by Abcam (1 mentions) Nrf1 antibody, by Abcam (1 mentions) Ab32063, by Abcam (1 mentions) Ab1791, by Abcam (1 mentions) Anti igg, by Abcam (1 mentions) Anti histone h3, by Abcam (1 mentions) Anti stat3, by Abcam (1 mentions) Smad3, by Abcam (1 mentions) Ab171870, by Abcam (1 mentions)

28 protocols using chip assay kit

1

ChIP-qPCR Analysis of PPAR-Alpha

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adipocytes were prepared for chromatin immunoprecipitation (ChIP) assay using a ChIP assay kit (Abcam) according to the manufacturer's protocol. Primary antibodies of PPARα (Abcam) or IgG (Abcam) were used. DNA–protein crosslinking complexes were collected, and purified DNA was subjected to qPCR with SYBR green fluorescent dye (Invitrogen, Carlsbad, CA, USA).
Liu Z., Gan L., Wu T., Feng F., Luo D., Gu H., Liu S, & Sun C. (2016). Adiponectin reduces ER stress-induced apoptosis through PPARα transcriptional regulation of ATF2 in mouse adipose. Cell Death & Disease, 7(11), e2487-.
+ Open protocol
+ Expand
2

ChIP Assay for Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed using a ChIP Assay Kit (Abcam) according to the manufacturer’s instructions. Briefly, cells were fixed, lysed, and sonicated to obtain DNA fragments in arranging in size from 200 to 1,000 bp. Chromatin was then precipitated with nonspecific IgG antibodies (Sigma), ChIP-grade rabbit anti-NR2F1 (Abcam), or ChIP-grade rabbit anti-H3 (Abcam). DNA was extracted and PCR was performed with primers for CXCL12, CXCR4 and CXCR7 promoter fragments.
Gao X.L., Zheng M., Wang H.F., Dai L.L., Yu X.H., Yang X., Pang X., Li L., Zhang M., Wang S.S., Wu J.B., Tang Y.J., Liang X.H, & Tang Y.L. (2019). NR2F1 contributes to cancer cell dormancy, invasion and metastasis of salivary adenoid cystic carcinoma by activating CXCL12/CXCR4 pathway. BMC Cancer, 19, 743.
+ Open protocol
+ Expand
3

Chromatin Immunoprecipitation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
A chromatin immunoprecipitation assay was used to study the interaction between intracellular DNA and protein. In this study, we used a ChIP assay kit (Abcam) to survey the relationship between the target gene promoter and the acetylated histone residue. Briefly, after cross‐linking the DNA and proteins by adding formaldehyde into the medium, the efficiency of formaldehyde was quenched by adding 0.125 mol/L glycine. Then, the DNA in cells was sheared into the average fragment (size: 200‐1000 bp) through lysis buffer and sonication. The antibody for the acetylated protein was used to immunoprecipitate the target DNA, and the DNA was eluted for real‐time PCR, ChIP or sequencing.
Fang Y., Chan L., Liou J., Tu Y., Lai M., Chen C., Vidyanti A.N., Lee H, & Hu C. (2020). HDAC inhibitor protects chronic cerebral hypoperfusion and oxygen‐glucose deprivation injuries via H3K14 and H4K5 acetylation‐mediated BDNF expression. Journal of Cellular and Molecular Medicine, 24(12), 6966-6977.
+ Open protocol
+ Expand
4

Sequential ChIP Analysis of Dvl2 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP analysis was carried out using ChIP Assay Kit according to the manufacturer's instructions (Abcam). For sequential ChIP, sheared chromatin was first immunoprecipitated with NICD antibody (Cell Signaling Technology) and then eluted with a second immunoprecipitation using Gli1 antibody (Novus Biologicals). DNA from each immunoprecipitation reaction was examined by PCR. The primer for the Gli1-responsive region of Dvl2 promoter: forward: 5’- GATGGGAAGTTTAGGGGCCAA -3’, reverse: 5’- AACTATAAGAGGGGCGGGGAT -3’. See Supplementary Materials.
Sheng M., Lin Y., Xu D., Tian Y., Zhan Y., Li C., Farmer D.G., Kupiec-Weglinski J.W, & Ke B. (2021). CD47-MEDIATED HEDGEHOG/SMO/GLI1 SIGNALING PROMOTES MESENCHYMAL STEM CELL IMMUNOMODULATION IN MOUSE LIVER INFLAMMATION. Hepatology (Baltimore, Md.), 74(3), 1560-1577.
+ Open protocol
+ Expand
5

ChIP-qPCR for C/EBPβ and HAS2-AS1 Binding

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To detect C/EBPβ and HAS2-AS1-binding sites, ChIP Assay Kit (ABCAM) was used to perform chromatin immunoprecipitation (ChIP) according to the instructions and established protocol (Ke et al., 2020 (link)); 200–1,000 bp DNA fragments were obtained by sonication. HFL-1 cells were cross-linked with formaldehyde. Subsequently, non-specific IgG antibodies (ab172730, Abcam) and C/EBPβ antibody (ab32358, Abcam) were precipitated with chromatin overnight at 4°C. NaCl was used to reverse DNA cross-linking, qRT-PCR was used to detect HAS2-AS1 level, and 2–ΔΔCT was used to calculate.
Yang X., Qi F., Wei S., Lin L, & Liu X. (2021). The Transcription Factor C/EBPβ Promotes HFL-1 Cell Migration, Proliferation, and Inflammation by Activating lncRNA HAS2-AS1 in Hypoxia. Frontiers in Cell and Developmental Biology, 9, 651913.
+ Open protocol
+ Expand
6

Analyzing LEF1 Transcriptional Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The nuclear fraction was extracted using the Nuclear Extraction Kit (Active Motif, CA, USA) and then immunoprecipitated with the ChIP assay kit (Abcam) according to the manufacturer’s instructions. Mouse anti-LEF1 antibody (1:200, ab137872, Abcam) and mouse IgG (Millipore) served as a negative control. Target fragments of promoters containing TCF/LEF1 response element (TRE) were then detected with agarose gel electrophoresis.
Huang W.J., Guo S.B., Shi H., Li X.L., Zhu Y., Li M., Song L.Y., Yu R.M., Cai Q.Q, & Tian X.P. (2023). The β-catenin-LINC00183-miR-371b-5p-Smad2/LEF1 axis promotes adult T-cell lymphoblastic lymphoma progression and chemoresistance. Journal of Experimental & Clinical Cancer Research : CR, 42, 105.
+ Open protocol
+ Expand
7

Chromatin Immunoprecipitation Assay for Hoxa5

Check if the same lab product or an alternative is used in the 5 most similar protocols
White adipocytes were prepared for chromatin immunoprecipitation (ChIP) assay using a ChIP assay kit (Abcam, Cambridge, UK) according to the manufacturer's protocol. Primary antibodies of Hoxa5 (Abcam) or IgG (Abcam) were used. DNA–protein crosslinking complexes were collected, and purified DNA was subjected to qPCR with SYBR green fluorescent dye (Invitrogen, Carlsbad, CA, USA).
Feng F., Ren Q., Wu S., Saeed M, & Sun C. (2017). Hoxa5 increases mitochondrial apoptosis by inhibiting Akt/mTORC1/S6K1 pathway in mice white adipocytes. Oncotarget, 8(56), 95332-95345.
+ Open protocol
+ Expand
8

Chromatin Immunoprecipitation Assay for Atf4

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation assay was performed as previous described using a ChIP assay kit (Abcam, UK, ab500) according to the manufacturer’s protocol (12 (link)). Primary antibodies of Atf4 and IgG (Abcam, UK, ab172730) were used. DNA–protein crosslinking complexes were collected, and purified DNA was subjected to qPCR with SYBR green fluorescent dye (Invitrogen, CA, USA).
Gan L., Liu Z., Luo D., Ren Q., Wu H., Li C, & Sun C. (2017). Reduced Endoplasmic Reticulum Stress-Mediated Autophagy Is Required for Leptin Alleviating Inflammation in Adipose Tissue. Frontiers in Immunology, 8, 1507.
+ Open protocol
+ Expand
9

ChIP Assay of p65-Bound PUMA Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assay using p65 antibody was performed using the ChIP Assay Kit from Abcam as described.38 For evaluation, the precipitates were used to PCR amplify PUMA promoter fragment having putative κB sites by using primers 5′‐GTCGGTCTGTGTACGCATCG‐3′ and 5′‐ CCCGCGTGACGCTACGGCCC‐3′.
Li L., Lin L., Li M, & Li W. (2019). Gilteritinib induces PUMA‐dependent apoptotic cell death via AKT/GSK‐3β/NF‐κB pathway in colorectal cancer cells. Journal of Cellular and Molecular Medicine, 24(3), 2308-2318.
+ Open protocol
+ Expand
10

Nrf1 Regulation of miR-378 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately 130 mg of livers from mice treated with HFD or SD was processed using the ChIP Assay Kit (Abcam, ab500) based on the manufacture’s protocol. Nrf1 Antibody was purchased from Abcam (ab34682). The binding region was detected in PCR reactions. A 10 kb region downstream from the binding site was used as a negative control and chromatin solution was reserved for input control. Primers flanking the binding site of Nrf1 within the murine miR-378 promoter were: forward, 5′-CTGGATGAAGAGCTCTCGTCCTTC -3′ and reverse, 5′-CTACCTGCGGGAGGAATTGTAGT -3′. The negative control primers were: forward, 5′-CTTCTATATGAAGAGACAGAGTAC -3′ and reverse, 5′-TGGAGTCCCTGCTATGTAGAGCCAG -3′. qPCR was used to determine the percentage of DNA precipitated by Nrf1 Antibody relative to the amount of input DNA (% input).
Zhang T., Zhao X., Steer C.J., Yan G, & Song G. (2018). A Negative Feedback Loop Between microRNA-378 and Nrf1 Promotes the Development of Hepatosteatosis in Mice Treated with a High Fat Diet. Metabolism: clinical and experimental, 85, 183-191.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!