Rna rapid extraction kit

An RNA Rapid Extraction Kit (Takara, Nanjing, China) was used to obtain the total RNA from the MG-63 cells. The cells were lysed with 800 μl of TRIzol lysis buffer. After centrifugation, the liquid phase was mixed with 1 ml of isopropanol and centrifuged at 12,000 x g for 10 minutes, and 30 μl of diethylpyrocarbonate (DEPC) was added to dissolve the RNA precipitate. Then, cDNA was synthesized by RNA using a cDNA reverse transcription kit (Vazyme, Nanjing, Jiangsu, China). The reaction conditions were: 70°C for 5 min, 37°C for 5 min, and 42°C for 60 min. Then, qRT-PCR was performed using the SYBR Green PCR Master kit (Vazyme, Nanjing, Jiangsu, China) in 20 μl reaction system. Then, transcription was performed with GAPDH as internal control. The primer sequences used were as follows:
The 2^−ΔΔCq method [18 (link)] was used for the quantification of relative gene expression.

Total RNA was isolated from CRC cells with an RNA rapid extraction kit (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocols. The concentration and purity of RNA products were measured via spectrophotometry. Then, 0.5 µg total RNA was reverse transcribed into cDNA using the Prime Script^® RT reagent kit (Takara Biotechnology Co., Ltd.); the reaction was incubated at 37°C for 15 min, and 85°C for 5 sec. Using SYBR Green Master Mix (Takara Biotechnology Co., Ltd., Dalian, China), qPCR was then performed to detect the expression levels of MMP1. The 20 µl reaction system for qPCR was: 10 µl SYBR Premix Ex Taq (X2), 8 µl cDNA template (diluted to a uniform level), 1 µl forward primer (10 µM), and 1 µl reverse primer (10 µM). Each sample had three repeats. The thermocycling conditions were as follows: 50°C for 3 min, 95°C for 3 min, and 40 cycles of 95°C for 10 sec and 60°C for 30 sec. A melting curve was subsequently generated. The sequences of primers used for amplification are listed in Table I. To evaluate the mRNA expression levels of MMP1, the 2^−ΔΔCq method (19 (link)) was employed. β-actin was taken as the reference gene for normalizing MMP1 expression.

RT-qPCR was performed as previously described.27 (link) Total RNA was extracted from the hippocampal tissues (n = 3) with RNA Rapid Extraction Kit (Takara, Japan). For subsequent experiments, the OD260/280 ratio of total RNA was maintained between 2.1 and 2.2. A total of 2 μg of RNA was reverse-transcribed into complementary DNAs with a First-Strand cDNA Synthesis kit (GeneCopoeia, Guangzhou, China). The levels of Nrf-2, HO-1, NQO1, and GAPDH mRNA were quantitatively analyzed using an RT-qPCR system (Bio-Rad, USA). The primer sequences used for RT-qPCR were listed in Table 1. Gene expressions of Nrf-2, HO-1 and NQO1 were analyzed using the Ct (2^−ΔΔCt) method. The expression levels were presented as the ratio of threshold cycle (Ct) values to GAPDH.Table 1

RT-qPCR Primer Sequences

Gene	Primer SEQUENCE
Nrf-2	F: GGACATGGAGCAAGTTTGGC
	R: CAGCGGTAGTATCAGCCAGC
HO-1	F: GACACCTGAGGTCAAGCAC
	R: ATCTTGCACCAGGCTAGCAG
NQO1	F: GACGCCTGAGCCCAGATATT
	R: AGCACTCTCTCAAACCAGCC
GAPDH	F: GGTCGGTGTGAACGGATTT
	R: GTGGATGCAGGGATGATGTT