Maloney murine leukemia virus reverse transcriptase

Total RNA was extracted from the entire brainstem and hypothalamus with a RNeasy Mini KitTotal RNA Isolation System (Qiagen, Valencia, CA), after which cDNA was synthesized by means of Maloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA). PCR amplification was performed by means of a PTC‐100 Programmable Thermal Controller (MJ Research, Waltham, MA) as follows: 1 cycle at 95°C for 15 min, followed by 35 cycles of 94°C for 45 sec, 55°C for 45 sec, and 72°C for 1 min. The bands were analyzed using UVP BioImaging Systems (Upland, CA). The primer sequences for AT1R and gp91^phox mRNA were as follows:

AT1R

Primer (S): GTGTTCCTGCTCACGTGTCT

Primer (AS): GATGATGCAGGTGACTTTGG

Probe: ATGAAGTCTCGCCTCCGCCG

gp91

Primer (S): GTGAGAGGTTGGTTCGGTTT

Primer (AS): CACCTCCATCTTGAATCCCT

Probe: CACCAAGGTGGTCACCCACCC

GAPDH

Primer (S): ACAACTTTGGCATTGTGGAA

Primer (AS): GATGCAGGGATGATGTTCTG

Probe: CATGCCATCACTGCCACCCA

Total RNA was extracted from cells with TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. RNA was treated with Turbo DNase (Invitrogen Ambion, Thermo Fisher Scientific) to eliminate any residual DNA from the preparation. Total RNA (1 μg) was reverse‐transcribed using the Maloney murine leukemia virus reverse transcriptase (Invitrogen) and 0.25 μg of Anchored Oligo(dT) 20 Primer (Invitrogen; 12577‐011). To control specificity of the amplified product, a melting curve analysis was carried out. No amplification of unspecific product was observed. Amplification of cyclophilin B (Ppib) was carried out for each sample as an endogenous control. Primer sequences were forward, 5′ GATCTCCTCCGCAGTCTGG 3′, and reverse, 5′ ACACAATGGGTATCCGGTCT 3′, for mouse Sall2 E1A; forward, 5′AACGGAGACCCCAACAGTTA 3′, and reverse, 5′ TGGGTCAGTGCAACATGAGT 3′, for mouse Sall2E1; forward, 5′ GTGCTGGGAATGCAAGCCATATCT 3′, and reverse, 5′ AAGCGGCTGGAAATGGCTTAGT 3′, for Ccne1; forward, 5′ AGGAAGCGGTCCAGGTAGTT 3′, and reverse, 5′ AGTGCGTGCAGAAGGAGATT 3′, for Ccnd1; forward, 5′ TTGTGGCCTTAGCTACAGGA 3′, and reverse, 5′ GCTCACCGTAGATGCTCTTT3′, for Ppib.
The relative expression of the Ccne1, Ccnd1, and Sall2 genes was calculated using the standard curve method, and all mRNA expressions were relative to Ppib.

Total RNA was extracted from cells with TRIzol reagent (Invitrogen; 15596026) according to the manufacturer’s instructions. RNA was treated with Turbo Dnase (Invitrogen; AM1907) to eliminate any residual DNA from the preparation. RNA (1 μg) was reverse transcribed using the Maloney murine leukemia virus reverse transcriptase (Invitrogen; 28025-01) and 0.25 μg of Anchored Oligo (dT) 20 Primer (Invitrogen; 12577-011). Real-time PCR was performed using KAPA SYBR FAST qPCR Master Mix (2X) kit and the AriaMX Real-Time PCR System (Agilent, Santa Clara, CA, United States) according to the manufacturer’s instructions. The thermal cycling variables used were as follows: 40 cycles at 95°C for 5 s and 60°C for 20 s. To control specificity of the amplified product, a melting-curve analysis was carried out. No amplification of unspecific product was observed. Amplification of RNA polymerase II (Polr2) was carried out for each sample as an endogenous control. Primers used for real-time reactions are summarized in Supplementary Table S1. The relative expression ratio of the Itgb1 gene was calculated using the standard curve method, using untreated Sall2^+/+ iMEFs as reference.

Whole kidneys from control and mutant animals were removed and placed in RNAlater (Ambion, Austin, TX) overnight in 4°C and then stored in −20°C. Total RNA was isolated using Trizol extraction (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. cDNA was prepared from 2 μg of RNA using Maloney murine leukemia virus reverse transcriptase (Life Technologies, Grand Island, NY) and an oligo(dT) primer according to the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed using SYBR Green I (Invitrogen Molecular Probes, Eugene, OR) in a CFXConnect system (BioRad, Hercules, CA). Renin and Jagged1 mRNA expression was normalized to GAPDH expression, and the changes in expression were determined by the ∆∆Ct method and are reported as relative expression compared to control mice. The following primers were used: renin forward 5’-ACAGTATCCCAACAGGAGAGACAAG-3’ and renin reverse 5’-GCACCCAGGACCCAGACA-3’; Jagged1 forward 5’-GCAACGACCGTAATCGCATC-3’ and Jagged1 reverse 5’-CCATTGCCGGCTAGGGTTTA-3’; GAPDH forward 5’-TTGATGGCAACAATCTCCAC-3’ and GAPDH reverse 5’-CGTCCCGTAGACAAAATGGT-3’.

Total RNA was isolated from the yolk sacs and livers of mouse embryos using Trizol extraction (Life Technologies, Grand Island, NY, USA) according to manufacturer’s instructions, as previously described^{51 (link)}. Complementary DNA (cDNA) was prepared from 2 µg RNA using Maloney murine leukemia virus reverse transcriptase (Life Technologies) and an oligo(dT) primer according to the manufacturer's instructions. PCR was performed on 2 µl cDNA using Taq DNA polymerase (Promega, Madison, WI, USA) in an Eppendorf thermocycler^{51 (link)}.