96 well optical plate

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

The 96-well optical plates are a laboratory equipment designed for use in a variety of scientific applications. They provide a standardized platform for performing high-throughput optical measurements, such as absorbance, fluorescence, and luminescence assays. The plates feature a 96-well format, with each well capable of containing a small volume of sample or reagent. The optical properties of the plates allow for accurate and precise optical measurements, making them a versatile tool for researchers and scientists working in fields such as life sciences, drug discovery, and analytical chemistry.

Automatically generated - may contain errors

Lab products found in correlation

41 protocols using 96 well optical plate

Quantification of Eukaryotic and Prokaryotic DNA in Bile

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Differentiation and quantification of eukaryotic and prokaryotic DNA from bile samples were carried out by qPCR using specific primers targeting the 18S rRNA gene of eukaryotic cells [40 (link)] and the 16S rRNA gene of prokaryotic microorganisms [41 (link)]. Amplification reactions were performed in 96-well optical plates (Applied Biosystems, Foster City, CA, USA) in a 7500 Fast RealTime PCR System (Applied Biosystems). Amplifications were done in triplicate in a final volume of 25 μl containing 2× SYBR Green PCR Master Mix (Applied Biosystems), 0.2 μM of each primer, and 1 μl of DNA obtained from bile. Primer efficiency was calculated from the slope of the standard curve (E = 10^−1/slope). Standard curves were generated by plotting the Ct values against the numbers of cells corresponding to serial tenfold dilutions of cultures of L. lactis strain NZ9000 as a reference for prokaryotic DNA and calculated by plate counting [42 (link)] and HT-29 cell line as a reference for eukaryotic DNA and titrated under an inverted microscope with a Neubauer Chamber [43 (link)]. To simulate different bacterial loads in the bile matrix, human bile was artificially supplemented with serial tenfold dilutions of known concentrations (ranged from 10² to 10⁷ cfu/ml) of a grown culture of L. lactis strain NZ9000.

Molinero N., Ruiz L., Milani C., Gutiérrez-Díaz I., Sánchez B., Mangifesta M., Segura J., Cambero I., Campelo A.B., García-Bernardo C.M., Cabrera A., Rodríguez J.I., González S., Rodríguez J.M., Ventura M., Delgado S, & Margolles A. (2019). The human gallbladder microbiome is related to the physiological state and the biliary metabolic profile. Microbiome, 7, 100.

+ Open protocol

+ Expand

Gene Expression Analysis under Temperature Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze the gene expression patterns under different temperature stresses, we performed q-RT-PCR using the gills sampled from the different temperature heat shocks and primers from a previous study (Kawabe and Yokoyama, 2011 (link)). q-RT-PCR was performed in the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, United States) using a SYBR Green real-time PCR mix (RR420A; Takara). Each 20 μl reaction mix included the following: 10 μl of 2SYBR Premix Ex Taq, 0.4 μl each of the forward and reverse primers, 0.4 μl 50ROX Reference DyeII, 2 μl of diluted cDNA, and 6.8 μl of DEPC-treated water. The reaction was performed in 96-well optical plates (Applied Biosystems, United States) under the following conditions: 30 s at 95°C, 3 s at 95°C for 40 cycles, and 30 s at 60°C. The results were analyzed with the 2^–Δ^Δ^ct method (Livak and Schmittgen, 2001 (link)).

Liu Y., Li L., Qi H., Que H., Wang W, & Zhang G. (2020). Regulation Between HSF1 Isoforms and HSPs Contributes to the Variation in Thermal Tolerance Between Two Oyster Congeners. Frontiers in Genetics, 11, 581725.

+ Open protocol

+ Expand

Quantitative PCR for Murine Polyomavirus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primer Express 3.0 software (Applied Biosystems, Warrington, UK) was used to design primers that amplified of a 67-bp region of the VP1 gene of the MuPyV genome (NCBI accession # NC_001515). Primers used for qPCR were: MuPyV VP1 forward primer, 5′TGGGAGGCAGTCTCAGTGAAA3′; MuPyV VP1 reverse primer, 5′TGAACCCATGCACATCTAACAGT3′. qPCR reactions were prepared in 96-well optical plates (Applied Biosystems) in a volume of 25 μl. Each reaction contained 450 nM of each forward and reverse primer, 12.5 μl FastSYBR Master Mix (Applied Biosystems) and 5 μl purified viral DNA or DNA standards. DNA amplification was carried out using a Biorad CFX96 thermocycler using cycling conditions of 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 sec, 60°C for 1 min. For each run, triplicates of five dilutions of the viral standard DNA (from 0.5 ng to 8×10-4 ng; pGEX-VP1 plasmid DNA), viral DNA samples and no template controls were simultaneously analyzed.

Heiser K., Nicholas C, & Garcea R.L. (2016). Activation of DNA Damage Repair Pathways by Murine Polyomavirus. Virology, 497, 346-356.

+ Open protocol

+ Expand

Semi-quantitative Real-Time PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Semi-quantitative Real-Time (TaqMan) PCR was carried out using the ABI Prism 7500 Sequence Detection System (Applied Biosystems) as previously described [34 (link),35 (link)]. DNase treatment and RT were performed as described above. PCR reactions were run in duplicates in 96-well optical plates (Applied Biosystems) under the following conditions: denaturation at 95 °C for 10 min, followed by 40 cycles each of 95 °C for 15 s and 60 °C for 60 s. The sequences for forward and reverse primers and TaqMan^® probes labeled with 6-carboxyfluorescein (6-FAM) and 6-carboxytetramethylrhodamine (TAMRA) were designed using Primer Express Software v 2.0 (Applied Biosystems) and were bought from Microsynth. The list of self-designed primers and TaqMan^® probes is presented in Table 1. In order to determine the expression of ICAM 1, a commercially available ovine-specific TaqMan Gene Expression Assay was used, purchased from Applied Biosystems (Prod. No. Oa04658646_m1).
In order to normalize gene expression levels of the target genes, GAPDH and ACTB were used as reference genes. The sample with the lower expression level was used as a calibrator. Calculation of the relative gene expression of each target gene was performed using the comparative CT method (ΔΔCT method) according to the ABI Prism 7500 (Applied Biosystems) manufacturer’s protocol and as previously described [34 (link),36 (link)].

Gram A, & Kowalewski M.P. (2022). Molecular Mechanisms of Lipopolysaccharide (LPS) Induced Inflammation in an Immortalized Ovine Luteal Endothelial Cell Line (OLENDO). Veterinary Sciences, 9(3), 99.

+ Open protocol

+ Expand

Thermal Stability Determination by DSF

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thermal stability was measured by differential scanning fluorimetry using Sypro Orange (Invitrogen), as previously described^{16 (link)}. Final mixtures of 30 μL were prepared at room temperature in 96-well optical plates (Applied Biosystems) and contained protein solutions at a final concentration of 0.5–1.5 μM in HEPES-buffered saline (10 mM HEPES pH 7.5, 200 mM NaCl). Where indicated, 50 mM maltose and 10 mM CaCl₂ were present. Each experiment contained control wells accounting for background protein, maltose and calcium fluorescence. Fluorescence data were collected on an Applied Biosciences Step-One Plus RT-PCR instrument equipped with fixed excitation wavelength (480 nm) and ROX® emission filter (610 nm). Thermal melts were performed from 25–95 °C with a 1 °C per min increase and acquired data were analyzed with Igor Pro, version 6.37 (WaveMetrics).

Patterson-Orazem A.C., Hill S.E., Wang Y., Dominic I.M., Hall C.K, & Lieberman R.L. (2019). Differential misfolding properties of glaucoma-associated olfactomedin domains from human and mouse. Biochemistry, 58(13), 1718-1727.

+ Open protocol

+ Expand

IgG Thermal Stability Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Melting temperatures were determined by differential scanning fluorimetry using Sypro Orange (Invitrogen) and 100 μM IgG in 50 mM sodium phosphate pH 7.2, 150 mM NaCl (PBS). Samples were prepared on ice and dispensed into 96-well optical plates (Applied Biosystems) in triplicate, 20 μl per well. Thermal melts were performed from 25 to 95 °C with a 1 °C per min ramp rate using a Thermo Fisher Scientific Viia7 RT-PCR instrument with fixed excitation wavelength (480 nm) and ROX emission filter (610 nm). Values represent an average of triplicate samples from two separate experiments with sample standard deviation.

Patterson-Orazem A.C., Qerqez A.N., Azouz L.R., Ma M.T., Hill S.E., Ku Y., Schildmeyer L.A., Maynard J.A, & Lieberman R.L. (2021). Recombinant antibodies recognize conformation-dependent epitopes of the leucine zipper of misfolding-prone myocilin. The Journal of Biological Chemistry, 297(3), 101067.

+ Open protocol

+ Expand

Quantifying Gut Bacterial Populations

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantification of the different bacterial populations in feces was performed by qPCR using group-specific primers targeting the 16S rRNA gene (Table 1). Amplification reactions were performed in 96-well optical plates (Applied Biosystems) in a 7500 Fast Real-Time PCR System (Applied Biosystems). All amplifications were performed in triplicate in a final volume of 25 μL containing 2x SYBR Green PCR Master Mix (Applied Biosystems), 0.2 μM of each primer and 1 μL of template DNA (5–10 ng). The thermal cycling protocol followed consisted of an initial cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s, and 1 min at the appropriate primer-pair annealing temperature (Table 1). To check for specificity, melting curve analysis was performed, increasing the temperature from 60 to 95°C at a rate of 0.2°C per second with the continuous monitoring of fluorescence. Primer efficiency was calculated from the slope of the standard curve for each primer set (E = 10^-1/slope). The different bacterial groups were expressed as relative quantities (percentage of the total bacterial 16S rDNA in the sample) according to Vigsnæs et al. (2011) (link).

Guadamuro L., Delgado S., Redruello B., Flórez A.B., Suárez A., Martínez-Camblor P, & Mayo B. (2015). Equol status and changes in fecal microbiota in menopausal women receiving long-term treatment for menopause symptoms with a soy-isoflavone concentrate. Frontiers in Microbiology, 6, 777.

+ Open protocol

+ Expand

Quantification of Lactobacilli in Feces

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantification of the group of lactobacilli in feces was performed by qPCR using the previously described group-specific primers (20 (link)) targeting a fragment of 341 bp of the 16S rRNA gene. Amplification reactions were performed in 96-well optical plates (Applied Biosystems Foster City, CA, USA) in two independent experiments using a 7500 Fast Real-Time PCR System (Applied Biosystems). Amplification were done with 2x SYBR Green PCR Master Mix (Applied Biosystems) according to previous reports (17 (link)), running samples and no template controls in duplicate wells, and controls for the standard curve in triplicate, into each plate. The standard curve (ranging from 10² to 10⁷ cfu/ml) was calculated using serial 10-fold dilutions of bacterial DNA extracted from a grown culture of Lactobacillus acidophilus DSM 20079, the number of cells being calculated by plate counting in MRS (Difco, Detroit, MI, USA) at 37°C. The efficiency was calculated from the slope of the standard curve (E = 10^−1/slope) with Ct values extrapolated by the ABI software (Applied Biosystems). Results were expressed as means of all determinations.

Guadamuro L., Diaz M., Jiménez S., Molinos-Norniella C., Pérez-Solis D., Rodríguez J.M., Bousoño C., Gueimonde M., Margolles A., Delgado S, & Díaz J.J. (2019). Fecal Changes Following Introduction of Milk in Infants With Outgrowing Non-IgE Cow's Milk Protein Allergy Are Influenced by Previous Consumption of the Probiotic LGG. Frontiers in Immunology, 10, 1819.

+ Open protocol

+ Expand

Optimized Droplet Sorting Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plate sorting was conducted using 96-well optical plates (Fisher Scientific) or qPCR plates (Biorad) on the Aria II and SH800 using associated 96-well plate gantries for each instrument. Prior to sorting, 100 μL of osmotically-balanced outer phase buffer was loaded into each well. Optimal drop delay was calculated for the Aria II instrument by using a blank droplet population, run the same day as the sample of interest. A protocol is available in ESI† methods. Briefly, blank droplets were sorted at set point of 50 droplets per well after Accudrop calibration and laser compensation, with each well corresponding to a different droplet delay setting (manually input) from −2.5 to +2.5 delay units in increments of 0.25 delay units from the Accudrop automatic droplet delay (Fig. S7†). Droplets were manually counted using a low-cost benchtop stereoscope (Amscope) to decide on the highest efficiency drop delay per the population; the process takes ~5–10 minutes and is a recommended step in calibration. Plate statistics were determined by 96-well optical images (EVOS microscope, 4× objective, Life Technologies) and manual counting. High-resolution droplet imaging used for size analysis and visualization was conducted using a Ti Eclipse microscope (Nikon) and sCMOS camera (Zyla 4.2, Andor) at 10× (16-bit, low-noise) with Brightfield Dichroic and eGFP filter sets (Semrock).

Brower K.K., Carswell-Crumpton C., Klemm S., Cruz B., Kim G., Calhoun S.G., Nichols L, & Fordyce P.M. (2020). Double emulsion flow cytometry with high-throughput single droplet isolation and nucleic acid recovery. Lab on a chip, 20(12), 2062-2074.

+ Open protocol

+ Expand

Optimized Droplet Sorting Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!