HEK293T cells were cultured in a 10-cm plate up to 80% confluence, followed by DMSO, i14G1-10 (20 µM), and i14G1-12 (10 µM) treatment. After 3 h, the cells were incubated with 100 µg/mL CHX for 5 min, washed with cold polysome buffer (20 mM Tris, pH 8, 140 mM KCl, 5 mM MgCl2, and 100 µg/mL CHX). Cells were collected in 500-µL polysome buffer supplemented with 0.5% Triton, 0.5% DOC, 1.5 mM DTT, 150 units RNase inhibitor, and 5-µL protease inhibitor mixture. Lysed samples were centrifuged at 12,000 rpm for 5 min at 4 °C. The cleared lysate was loaded onto a sucrose density gradient (10 to 50%) and centrifuged at 38,000 rpm for 105 min at 4 °C. Gradients were fractionated with continuous absorbance measurement at 254 nm using the ISCO absorbance detector UA-6. Fractions were pooled according to their absorbance into free, light, and heavy ribosomal fractions. RNA was isolated from each respective sample using BioTri-Reagent and Direct-Zol RNA miniprep kit (Zymo Research). Complementary DNA (cDNA) was prepared from 1 µg RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems). Real-time PCR was done using qPCRBio SyGreen Blue mix (PCR Biosystems) on Quantstudio 6 Flex Real-time PCR system.
Qpcrbio sygreen blue mix
Manufactured by PCR Biosystems
Sourced in United Kingdom
QPCRBIO SyGreen Blue Mix is a ready-to-use qPCR master mix that contains SYBR® Green I for real-time quantification of DNA targets. The mix includes a DNA polymerase, dNTPs, MgCl2, and a qPCR buffer.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Direct zol rna miniprep kit, by Zymo Research (3 mentions)
M mlv reverse transcriptase, by Promega (3 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Qpcrbio cdna synthesis kit, by PCR Biosystems (2 mentions)
Real time pcr machine, by PCR Biosystems (2 mentions)
Qscript cdna synthesis kit, by Quantabio (2 mentions)
Tri reagent, by Merck Group (2 mentions)
Dataassist software v3, by Thermo Fisher Scientific (2 mentions)
Quantstudiotm 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase 1, by Qiagen (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Lightcycler 96, by Roche (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rt2 first strand synthesis kit, by Qiagen (1 mentions)
Quantitech primer assay, by Qiagen (1 mentions)
Rotor gene 6000, by Qiagen (1 mentions)
17 protocols using qpcrbio sygreen blue mix
1
Polysome profiling of HEK293T cells
2
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Messenger RNA was isolated from cell lysates using the RNeasy Mini Kit (Qiagen, 74104), and cDNA was synthesized from each sample using the RT2 first strand synthesis kit (Qiagen, 330401). Changes in gene expression in response to PIM1 loss were measured as follows: qRT-PCR reactions were performed with equal amounts of starting material (1000 ng RNA) using qPCRBIO SyGreen Blue Mix (PCR Biosystems, PB20.15-01), according to the manufacturer’s protocol. Validated primer sets (QuantiTech primer assays; Qiagen) for each of the following genes were purchased to measure gene expression: PPARα, PPARβ, PPARγ, PEX3, PEX5, PEX7, and Tip47. All primers were ordered from IDT. GAPDH was used to normalize.
3
Quantitative Analysis of Autophagy Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was analyzed by quantitative reverse transcription PCR (RT-qPCR), using the Rotor-Gene 6000 instrument (Corbett Life Science, Mortlake, Australia). Total RNA was isolated from podocytes using EZ-10 DNAaway RNA Miniprep kit (Bio Basic Canada Inc., Markham, ON, Canada), according to manufacturer instructions. Real-time PCR was performed following cDNA synthesis (qPCRBIO cDNA Synthesis Kit, PCR Biosystems) using qPCRBIO SyGreen Blue Mix (PCR Biosystems), according to the manufacturer’s instructions. The following PCR primers were used: hB2M fw 5′ TGC TGT CTC CAT GTT TGA TGT ATC T 3′, rev 5′ TCT CTG CTC CCC ACC TCT AAG T 3′; hATG5 fw 5′ GCA AGC CAG ACA GGA AAA AG 3′, rev 5′ GAC CTT CAG TGG TCC GGT AA 3′; hATG12 fw 5′ CGA ACA CGA ACC ATC CAA GG 3′, rev 5′ TCA CTG CCA AAA CAC TCA TAGA 3′; and BECN1 fw 5′ ATG CAG GTG AGC TTC GTG TG 3′, rev 5′ CTG GGC TGT GGT AAG TAA TGG A 3′. Gene expression was calculated using a standard curve which relates Ct to concentration. Gene expression of the target sequence was normalized to a housekeeping gene, B2M. Results of Hepa (H) cells were expressed relative to control mock-infected (V) cells, which was arbitrarily assigned a value of 1.
4
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using an RNA/Protein extraction kit (MACHEREY-NAGEL). cDNA was synthesized from total RNA (2 μg) using M-MLV Reverse Transcriptase (Promega, M1705). qRT-PCR was performed on a LightCycler 96 System (Roche) using qPCRBIO SyGreen Blue Mix (PCR Biosystems, PB20.15), according to the manufacturer's instructions. The following targets were amplified using the indicated primer pairs (Table S3† ).
5
Quantitative PCR Analysis of Embryonic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
0–8h embryos were collected and aged at 25°C as indicated. For each time point, WT (Cas9) and two independent mDPE (F3, M6) strains were collected and processed in parallel. Total RNA was extracted from dechorionated embryos using the TRI Reagent (Sigma-Merck) according to the manufacturer’s protocol, followed by ethanol precipitation for further purification. 1 μg RNA was further used for cDNA synthesis (qScript cDNA Synthesis Kit, Quantabio). Quantitative PCR using SYBR green (qPCRBIO SyGreen Blue Mix, PCR Biosystems) was performed using a StepOnePlus Real-Time PCR machine. Control reactions lacking reverse transcriptase were also performed to ensure that the levels of contaminating genomic DNA were negligible. Transcript levels were analyzed by the ΔΔCT method using Polr2F (RpII18) as an internal control. Each sample was run in triplicates. Statistical analysis was performed using ‘HH’ R package (https://CRAN.R-project.org/package=HH ), with mean and standard deviation values exported from StepOnePlus software.
Primer sequences are provided inSupplemental File S4 .
Primer sequences are provided in
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from mammalian cells were extracted with Nucleozol reagent (Machnery-Nagel). Complementary DNA was synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio) according to the manufacturer’s instructions. RT-qPCR was performed on a BioRad CFX96 machine using qPCRBIO SyGreen Blue Mix (PCR Biosystems) to quantify the expression of the target genes. The expression levels were normalized to β-actin for each sample. The primers used for qRT-PCR are listed in Supplementary Data 3 .
7
Induced IgA Switching in B Cells
8
Chondrocyte Total RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The concentration of total RNA isolated from chondrocytes using TRIzol reagent (Invitrogen, USA) was determined by a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). cDNA was synthesized from quantified total RNA using ThermoScriptTM RT-PCR system (Invitrogen) in TaKaRa PCR Thermal Cycler Dice (TaKaRa Bio, Japan). For conventional PCR, PCR products amplified from cDNA using 2× TOP simple DyeMIX-nTaq (Enzynomics, Korea) and specific primers of target gene (summarized in Table 1 ) in TaKaRa PCR Thermal Cycler Dice were loaded on an agarose gel to elucidate the alteration of target gene. For quantitative real-time PCR (qRT-PCR), cDNA was amplified by qPCRBIO SyGreen Blue Mix (PCR Biosystems, UK) and specific primers of target gene (summarized in Table 1 ) in Eco Real-Time PCR system (Illumina, USA). Relative ratio of target gene induction was measured by the ΔΔCT method (Illumina).
9
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNeasy plus mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, including treatment with RNase-free DNase I (Qiagen, Hilden, Germany). cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). qPCR was performed using qPCRBIO SyGreen Blue Mix (PCR Biosystems, London, UK) and run on a QuantStudioTM 6 Flex Real-Time PCR System (Applied Biosystems). Primer sequences used were predesigned KiCqStart SYBR® Green primers (Sigma-Aldrich Israel Ltd, Rehovot, Israel) and are included in Supplementary Materials Table S13 . The expression of the indicated transcript was normalized to endogenous reference control GAPDH according to the ΔΔCt method using the DataAssist software v3.0 (Applied Biosystems).
10
Quantitative Analysis of Oatp30B Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted as previously reported71 (link) from 15 adult flies of both sexes, aged 15 days at 29 °C to allow RNAi expression and knockdown, using TriZol (Thermo-Fischer). cDNA was generated using SuperScript III Reverse Transcriptase (Thermo-Fischer). Quantitative PCR was performed in combination with qPCRBIO SyGreen Blue mix (PCR Biosystems) on Quantstudio 7 from real-time PCR system (Thermo-Fischer). eIF4a was used as housekeeping control. The following oligos were used: Oatp30B Fw (GAATCCGACCAACCGCCTGA), Oatp30B Rv (ATGGATTCCTGCCGCCTGTG), eIF4a Fw (CGTGAAGCAGGAGAACTGG), eIF4a Rv (CATCTCCTGGGTCAGTTG).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!