Rotor gene rg 6000

Specific gene expression levels were measured by quantitative PCR after reverse transcription (RT-qPCR), as previously described (Richardot et al., 2016 (link)). RNA was reverse transcribed with ImProm-II reverse transcriptase, according to the manufacturer’s protocol (Promega, Madison, WI, United States). Amounts of specific cDNA were assessed on a Rotor Gene RG6000 instrument (Qiagen, Courtaboeuf, France) by using the QuantiFast SYBR green PCR Kit (Qiagen) and primers annealing to target gene sequences (Supplementary Table 1). For each strain, target gene mRNA levels were normalized to that of housekeeping gene rpsL, and were expressed as a ratio to the transcript levels of strain PA14. Mean gene expression values were calculated from two independent bacterial cultures, each assayed in duplicate. As shown previously, transcript levels of mexB ≥ 3-fold, mexY ≥ 5-fold, mexC, and mexE ≥ 20-fold those of PA14, were considered as significantly increased because associated with a ≥ 2-fold higher resistance to respective pump substrates (Llanes et al., 2013 (link); Richardot et al., 2016 (link)).

RNA was extracted from whole lungs, after micro-CT scanning. qPCR was performed using the SensiMIX™ SYBR® Hi-ROX kit (Bioline) and analysed on a Corbett Rotor Gene RG-6000 using cycling parameters: initial hold for 10 min at 95 °C, 40 cycles of 95 °C for 10 s, 60 °C for 15 s, 72 °C for 20 s, and acquisition on the green channel. Rotor-Gene 6000 series software version 1.7 was used to analyse the results. ΔΔCt values were calculated and normalised to the 18S rRNA reference gene.

A two-step PCR generated rbcL and ndhJ barcodes from scat/autopsy samples. First, the following Illumina sequences were added to the 5' end of primers:
F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG,
R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.
Initial amplification was performed in 20μl of: 1x MyFi Buffer, 1.6U MyFi Polymerase (Bioline), 200 pM of each forward and reverse primers, and 20 ng DNA. PCR conditions for rbcL and ndhJ: 95°C (1 min) followed by 35 cycles of 95°C 15 s, 55°C 15 s, 72°C 15 s. Products were purified using the Agencourt AMPure XP PCR Purification beads at a v/v ratio of 0.6x beads/PCR product.
Second PCR was performed in 12.5 μl volumes of: 1x MyFi Buffer (Bioline,); 0.4 nM of paired Nextera 96 Indices (Illumina); 1.6U MyFi Polymerase (Bioline) and 2 μl of purified initial amplicon. Thermocycling conditions were: 95°C 1 min, then 5 cycles 95°C 5 s, 55°C 10 s, 72°C 10 s. Products were purified as above and quantified by qPCR calibrated to known PhiX standards (Illumina) using the SYBR FAST qPCR Kit (Kapa Biosystems) on a RotorGene RG-6000 (Corbett).
Indexed libraries were pooled and 16 pM aliquots were paired-end sequenced on a MiSeq sequencer using a 600-cycle Version 3 kit (Illumina). The MiSeq Bcl output files were de-multiplexed and converted to FASTQ files using MiSeq Reporter v2.6 software (Illumina).

Total RNA was prepared using the RNeasy Micro kit (Qiagen) from FACS-sorted luminal cells isolated from the mammary glands of FVB/N dams at 18.5 dP or 2 days of lactation, or from total mammary tissue derived from AURKA-deficient or control mice at 14 days of lactation. Reverse transcription was carried out using oligo(dT) primer and SuperscriptIII reverse transcriptase (Invitrogen, MA, USA). Quantitative RT–PCR analysis was performed using a Rotorgene RG-6000 (Corbett Research, Australia) and normalized against 18S ribosomal RNA.

Human and mouse RNA was extracted from snap-frozen sorted cell pellets using a RNeasy Micro Kit (Qiagen), and DNase treatment was performed using the TURBO DNA-free Kit (Ambion) according to the manufacturer’s instructions. RNA sequencing was performed on an Illumina HiSeq at the Australian Genome Research Facility. Per human sample, 16–26 million 100 bp single-end reads were generated, and 13–17 million 100 bp single-end reads were generated per mouse sample. For human qPCR analyses, cDNA was generated using the SuperScript III system (Life Technologies) and subject to qRT-PCR using the Sensimix SYBR Hi-Rox kit (Bioline) on the Rotorgene RG-6000 (Corbett Research) under standard conditions. Three technical replicates were performed for each sample. Taqman gene expression assays were used for MUC5AC (Hs0087365_mH) and FOXJ1 (HS00230964_m1) using 18S (HS99999901_s1) or GAPDH (HS99999905_m1) as reference genes (Life Technologies). The sequence of the primers is available in S1 Table.

Total RNA was isolated using an RNeasy Mini Kit (QIAGEN, VIC, Australia). RNA concentrations and quality were determined using a NanoDrop-3000 Spectrophotometer (NanoDrop Technologies, Inc., NC, USA). Four micrograms of total RNA was reverse-transcribed with 200 units of Superscript III Reverse Transcriptase (Invitrogen Life Technologies, CA, USA) and 0.5 μg of oligo (dT) 15 primers (Roche Diagnostics, Mannheim, Germany) in a reaction volume of 20 μL. RT-PCR was performed using 3 μL of cDNA (represented 6 ng RNA), 0.5 μM of each primer (Table 1), and FastStart SYBR green PCR Master (Roche Diagnostics, Mannheim, Germany) in a Rotor Gene RG-6000 (Corbett Research, NSW, Australia). To quantify the gene expression profile in each sample, the efficiency of each standard curve was determined by its slope and comparative threshold. Data were presented as ratio of the amount of targeted mRNA (arbitrary units) normalised with the house-keeping gene beta 2-microglobulin (β2M)