Tri reagent protocol

The total RNA was extracted from the tomato leaf tissues as described in the TRI reagent protocol (Takara Bio Inc.). The total RNA and cDNA syntheses were performed according to the manufacturer's instructions. The primers were designed according to the NCBI (Supplementary Table 1). qRT-PCR was performed with the SYBR PrimeScript™ RT-PCR Kit (Takara Bio Inc.) according to the manufacturer's instructions. All experiments were repeated three times and the relative gene expression was calculated by the 2^−ΔΔCt method.

Root tissues were harvested at 1, 3, 9 days after inoculation with FOC. The total RNA was extracted according to the TRI reagent protocol (Takara Bio Inc.) and then converted into cDNA following the manufacturer's instructions. Primers were designed based on the sequences obtained from NCBI using Beacon Designer 7.90 (Supplementary Table 1). qRT-PCR was performed using the SYBR PrimeScript™ RT-PCR Kit (Takara Bio Inc.) in accordance with the manufacturer's instructions and run on a StepOne™ real-time PCR system (Applied Biosystems, Singapore). The relative gene expression was calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)), and the methods were based on a previously described protocol (Shi et al., 2016 (link)). All reactions were conducted with three biological replicates.

Total RNA was extracted from leaves as described in the TRI reagent protocol (Takara Bio Inc). Primers were designed according to cucumber databases ¹. and NCBI. Gene specificprimers used for real-time quantitative PCR are provided in the following primers: SOD: forward CCTAAACTCTCGTGAATGA and reverse CAGCAGACAAGTATGGATA; POD: forward TTGTAATAATGGCGGCTT and reverse GTGTCATAGAAGGTGGAG; cAPX: forward TGCTTTCATCACCATCAA and reverse TGTTATGTTCTTGTCTTCCT. Actin: forward CCACCAATCTTGTACACATCC and reverse AGACCACCAAGTACTACTGCAC. qRT-PCR was performed on a StepOnePlus^TM Real-Time PCR System (Applied Biosystems) using a SYBR^® Premix Ex Taq^TM II (Tli RNaseH Plus) kit (Takara). The PCR reactions were carried out in triplicate and the thermocycler conditions, 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and a final extension of 30 s at 60°C. Relative expression was calculated according to the 2^-ΔΔCT method, the relative gene expression level was normalized against actin (the internal standard gene).