On day 40, cecum contents were collected randomly from 14 birds from each of the treatment groups. Samples were directly transported to the lab in sterile containers under ice and stored at -80°C. Total DNA was extracted using a protocol designed and described previously by Stanley et al. [15 (link)] with minor modifications. The quality and quantity of DNA were confirmed using a Nanodrop spectrophotometer. Hypervariable regions V3–V4 of the 16S rRNA gene were amplified and sequenced to determine the cecal microbiota using primers; forward ACTCCTACGGGAGGCAGCAG , reverse GGACTACHVGGGTWTCTAAT . Primers used were uniquely barcoded and contained Illumina spacers and sequencing linkers, using an approach that has been proposed by Fadrosh et al. [16 (link)]. The sequencing library was prepared by following the manufacturer's protocol (Illumina Inc., San Diego, CA, USA). Sequencing was performed using the Illumina MiSeq 2x300 bp paired-end sequencing.
Miseq 2x300 bp
Manufactured by Illumina
Sourced in Germany
The MiSeq 2x300 bp is a sequencing system designed for targeted gene sequencing applications. It provides up to 15 Gb of sequencing data per run with read lengths of up to 300 base pairs in both forward and reverse directions.
Automatically generated - may contain errors
4 protocols using miseq 2x300 bp
1
Cecal Microbiome Analysis of Poultry
2
Comprehensive Analytical Techniques for Microbial Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The values of pH were monitored by pH meter (OHAUS, ST3100C). TS, and VS were measured according to the standard methods [29 ]. The analytical method of F420 was previously described in the literature [30 ]. The total carbon (TC) and total nitrogen (TN) were measured by an elemental analysis instrument (VARIOEL Ш, Germany), and 16s rRNA gene amplification sequencing was obtained using an NGS Illumina MiSeq 2 x 300 bp.
3
Stool DNA Extraction and 16S Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from 200 mg of each frozen stool sample using the PSP Spin Stool DNA Kit (Stratec Molecular, Berlin, Germany), following the manufacturer's protocol. Briefly, stool samples were lysed under denaturing conditions at 95 °C and then treated with proteinase K at 70 °C. DNA was purified through a spin column system, eluted, and quantified using a NanoDrop spectrophotometer ND1000 (ThermoFisher). Sequencing of 16S rRNA amplicons (V3-V4 regions) was performed using Illumina MiSeq 2x300bp.
4
Viral Pathogen Enrichment and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before library preparation, NA were retrotranscribed to cDNA, tagged and complemented to obtain dsDNA. This viral randomly tagged dsDNA was then amplified (25 cycles) to obtain the sufficient amount of DNA for the preparation of libraries, as previously described (Fernandez-Cassi et al., 2018 (link)). Libraries were prepared in duplicate using KAPA HyperPrep Kit following the instructions provided by the manufacturer (Roche-Kapa Biosystems). One replicate of the libraries was hybridized with probes designed to capture sequences from vertebrate viral pathogens (VirCapSeq Enrichment Kit, Roche). Two negative controls were also processed, one of them with the enrichment kit.
After the capture, quality and concentration were re-checked and sequencing of the libraries from the captured, non-captured, and negative controls was performed (Illumina Miseq 2x300bp).
Clinical samples were sequenced in an independent Illumina Miseq 2×300bp run (in this case, consensus sequences were assembled with reads produced from another Illumina TruSeq high coverage sequencing run on same samples, and are already available at GISAID as EPI_ISL_418860 and EPI_ISL_418861, respectively).
After the capture, quality and concentration were re-checked and sequencing of the libraries from the captured, non-captured, and negative controls was performed (Illumina Miseq 2x300bp).
Clinical samples were sequenced in an independent Illumina Miseq 2×300bp run (in this case, consensus sequences were assembled with reads produced from another Illumina TruSeq high coverage sequencing run on same samples, and are already available at GISAID as EPI_ISL_418860 and EPI_ISL_418861, respectively).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!