We used the 5′ and 3′ RACE analyses to determine the transcriptional initiation and termination site of GCASPC using a SMARTer RACE cDNA Amplification kit (Clontech, Palo Alto, CA, USA), according to the manufacturer’s instructions. PCR of the internal region was performed when starting points of 5′ and 3′ RACE had an unamplified gap. RACE PCR products were separated on a 1.5 % agarose gel. Gel products were extracted with the Gel and PCR Clean-Up System (Promega, A9282), cloned into the pGEM-T Vector Systems I (Promega, A3600) and sequenced bidirectionally using the M13 forward and reverse primers by Sanger sequencing at Invitrogen. At least five colonies were sequenced for every RACE PCR product that was gel purified.
Gel and pcr clean up system
Manufactured by Promega
Sourced in United States
The Gel and PCR Clean-Up System is a laboratory tool designed to purify DNA fragments from agarose gels and PCR reactions. It efficiently removes unwanted primers, nucleotides, enzymes, and other contaminants from the target DNA, providing a clean and concentrated sample for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Zero blunt topo pcr cloning kit, by Thermo Fisher Scientific (2 mentions)
Q5 hot start high fidelity master mix, by New England Biolabs (2 mentions)
Epitect kit, by Qiagen (2 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Smarter race cdna amplification kit, by Takara Bio (1 mentions)
Anti foxp3 alexa 488, by BioLegend (1 mentions)
Recombinant taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Anti cd28 mab, by BioLegend (1 mentions)
Anti cd4 alexa488, by BioLegend (1 mentions)
Anti cd3 mab, by BioLegend (1 mentions)
Anti cd25 percp, by BioLegend (1 mentions)
Anti tim 1 pe, by BioLegend (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Rneasy cleanup kit, by Qiagen (1 mentions)
Tianprep mini plasmid kit, by Tiangen Biotech (1 mentions)
Pcr4blunt topo vector, by Thermo Fisher Scientific (1 mentions)
Methyl primer express v1, by Thermo Fisher Scientific (1 mentions)
Sanger sequencing, by Sangon (1 mentions)
8 protocols using gel and pcr clean up system
1
Determining Transcriptional Boundaries of GCASPC
2
Regulatory T Cell Isolation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CB was from Merck-Millipore, Darmstadt, Germany. Anti-CD3 mAb, anti-CD28 mAb, anti-phosphotyrosine (anti-pTyr) PY20-Alexa 488, anti-CD4-Alexa 488, anti-CD25-PercP, anti-FOXP3-Alexa 488, and anti-TIM-1-PE were from Biolegend, San Diego, CA, United States. Rabbit anti-mouse-IgG1 and IgG2a were from Fisher Biotec, Hampton, New Hampshire, United States. Carboxyfluorescein diacetate succimidylester (CFSE) was from Biolegend. The 7-Plex T-Cell Receptor Th17 and IL-17 Magnetic beads MAGPIX Kits were from Merck-Millipore. Treg (CD4+CD25+CD127low) and CD4+ T cell isolation kit were from Miltenyi Biotec, Bergisch Gladbach, Germany. The primers were from IDT, Coralville, Iowa, United States. The DNA Extraction and Purification Kit and Gel and PCR Clean-up System were from Promega, Madison, Wisconsin, United States. Recombinant Taq DNA Polymerase was from Thermo Fisher Scientific, Waltham, Massachusetts, United States, and QIA Quick PCR purification kit was from Qiagen, Hilden, Germany.
3
Cloning and Expression of Lsm14a in Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used control cDNAs (reverse-transcribed as above) as templates for amplification. Lsm14a DNA was amplified via nest PCR, using outer primers comprising 5′-CGGGATCTGACTGAGTGCGA-3′ (forward), and 5′-CTCTACCATCCAGCACCCT-3′ (reverse), and primers with a restriction enzyme site comprising 5′-GAATTCGATGAGCGGGGGCACCCCTTA-3′ (forward with EcoRI site), and 5′-GGCGCGCCTTAGGGTCCAAAAGCCG-3′ (reverse with AscI site). The fragment was linked to a T-vector (TAKARA), and digested with EcoR1 and Asc1 enzymes. The purified DNA fragment was then recombined into a PCS2+-myc plasmid digested with the same enzymes, and combined plasmids were transfected into Trans10 competent cells (TransGene, Beijing, China). Positive strains were selected to perform further experiments, and plasmids were extracted from bacteria using the TIANprep Mini Plasmid Kit (TIANGEN, Beijing, China), linearized with SalI enzyme, and purified via the Gel and PCR Clean-Up System (Promega, Madison, WI, USA). Capped mRNAs were produced using the Sp6 mMessage mMACHINE Kit (Qiagen, Austin, TX, USA) and purified the RNeasy clean up kit (Qiagen). We used nuclease-free water to dilute mRNAs to a concentration of 2.0 mg/ml prior to injection. Injected oocytes were suppressed in M2 medium containing milrinone for 4 h, and then washed in milrinone-free M2 medium to resume meiosis.
4
Profiling IRF7 Promoter Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231 and BT-549 cells (1×105/wells) were grown on 6 cm dishes for 24 h, and then exposed to vehicle or the corresponding drugs for 48 h. Then, genomic DNA was extracted, followed by bisulfite treatment using the Qiagen EpiTect kit. PCR cycle (98°C for 30 s; followed by 35 cycles of 98°C for 10 s, 60°C for 30 s, and 72°C for 10 s; 72°C for 2 min; 4°C hold) was conducted with Q5 Hot Start High-Fidelity Master Mix (NEB). Methyl Primer Express™ v1.0 (ThermoFisher) was used to design primer sequences for IRF7 promoter region (F: 5′-TTGGGTTGTAGTGGAGTGGTTTTATT-3′; R: 5′-CATCTCTCAAACTCCCCCAACTCTT-3′). The PCR products were detected through electrophoresis and purified by Gel and PCR Clean-up System (Promega). After purification, Zero Blunt™ TOPO™ PCR Cloning Kit (Invitrogen) was used to insert the products into pCR™4Blunt-TOPO® Vector. Lastly, Sanger sequencing (Sangon) was carried out.
5
Bacterial 16S rRNA Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of all the bacterial strains was extracted using GeneJet Genomic DNA Isolation Kit (@Thermo Scientific Waltham, USA) according to the mentioned protocol. The 16S rRNA genes of the bacterial strains were amplified using universal primer pair 27F (5´ -AGAGTTTGATC-MTGGCTCAG- 3´) and 1492R (5´ -GGTTACCTTGTTAC-GACTT- 3´), respectively by PCR. The amplified PCR products were visualized under a UV transilluminator and were purified from the bands (approx;1500 bp) using Gel and PCR Clean-Up System (Promega, USA). The bacterial species were determined by 16S rRNA genes sequencing. The obtained forward and reverse sequences were joined together in the DNASTAR program. The final sequences were BLAST to retrieve the identical bacterial sequences. All the sequences were then aligned in CLUSTALW. The phylogenetic tree was made using MEGA X program (version 10.1.7) with 1000 bootstraps. The Neighbor-Joining method was followed to study the evolutionary relationships between our bacterial isolates sequences and all the retrieved sequences [23 (link)].
6
Confirming FGFR2-SKI Fusion in PDX Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from PDX KCC_P_4043 with a RNeasy mini kit (Qiagen) following the manufacturer’s protocol and quantified using a Nanodrop ND-1000 (NanoDrop Technologies). RNAs were reverse transcribed using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific). Subsequently, cDNA was PCR amplified to confirm the fusion of FGFR2 and SKI using forward primers to FGFR2 exon 10 (AACAACACGCCTCTCTTCAACG), 11 (GTTGCTTTGGGCAAGTGGTC) or 12 (CTTCTTGGAGCCTGCACACA) and reverse primers to SKI exon 2 (TTTTGGGTCTTATGGAGGCCG, CTTGTCCTTTTCGGAAGGCG, AGCCCAGGCTCTTATTGGAA). The PCR products were resolved by gel electrophoresis, and the bands at the predicted product size were excised and purified with a gel and PCR clean-up system (Promega) for Sanger sequencing by the Micromon facility at Monash University. Reactions were repeated on four biological replicates.
7
Bisulfite Sequencing of TET2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF-7 cells ( ) were plated in dishes for 24 h, followed by treatments with BPA, BPS, or vehicle for 48 h, and the genomic DNA was then extracted from the harvested MCF-7 cells using a Genomic DNA Purification Kit (Promega). The specific primers for TET2 promoter region (forward: 5′-TTTTTTTTTAGGGGTGGA-3′; reverse: 5′-ACTTACATACGAACGAAACCC-3′) was designed by Methyl Primer Express™ (version 1.0; ThermoFisher). Bisulfite treatments of the genomic DNA samples were carried out with the Qiagen EpiTect kit according to the manufacturer’s instructions, followed by the PCR amplification procedure (98°C 30 s; 98°C 10 s, 60°C 30 s, 72°C 10 s, 35 cycles; 72°C 2 min; 4°C hold) using Q5 Hot Start High-Fidelity Master Mix (NEB). The PCR products were identified by electrophoresis and gel-purified with the Gel and PCR Clean-up System (Promega). The purified PCR products were inserted into pCR™4Blunt-TOPO® Vector using the Zero Blunt™ TOPO™ PCR Cloning Kit (Invitrogen) and sequenced by Sanger sequencing (Sangon).
8
Identifying FGFR4 Kinase Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from parental MDA-MB-453 and long-term BLU9931 MDA-MB-453 cells using a RNeasy mini kit (Qiagen) following the manufacturer's protocol. RNA was quantified using a Nanodrop ND-1000 (NanoDrop Technologies). RNAs were reverse transcribed using a high-capacity cDNA reverse transcription kit (Thermoscientific). Subsequently, cDNA was amplified by PCR to identify gatekeeper mutations in the FGFR4 kinase domain using forward (F) primers and reverse (R) primers (Table S4). The PCR products were resolved by gel electrophoresis, and the bands at the predicted product size were excised and purified with a gel and PCR clean-up system (Promega). Sanger sequencing was completed by the Micromon facility at Monash University. Reactions were repeated on three biological replicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!