Stable KD of endogenous h6PGD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT -3’). The shRNA is designed to target the 3' non-coding region of h6PGD-A mRNA and shows no effect on the plasmid directed expression of 6PGD cDNA in cells. Stable KD of endogenous hG6PD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT-3’). Stable KD of endogenous hAMPK was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGCATAATAAGTCACAGCCAAACTCGAGTTTGGCTGTGACTTATTATGCTTTTT -3’). Antibodies against AMPK (cat# 5831), phospho-AMPK (T172) (cat# 2535), ACC1 (cat# 3662), and phospho-ACC1 (S79) (cat# 11818), G6PD (cat# 12263), and LKB1 (cat# 3050) were from Cell Signaling Technology (CST); antibody against 6PGD was from Novus (cat# NBP1-31589); antibody against β-actin was from Sigma (cat# A1978); prediluted Ki67 antibody was from Invitrogen (cat# 08-0156). Physcion was purchased from Santa Cruz Biotechnology. 1-hydroxy-8-methoxy-anthraquinone (S3) was purchased Sigma. DHEA was purchased from Calbiochem. DHA was purchased from TCI America. A769662 was purchased from LC Laboratories. Compound C was purchased from EMD Millipore.
Phospho acc1 s79
Manufactured by Cell Signaling Technology
Phospho-ACC1 (S79) is a primary antibody that detects acetyl-CoA carboxylase 1 (ACC1) phosphorylated at serine 79. ACC1 is a key enzyme involved in fatty acid synthesis. Phosphorylation of ACC1 at serine 79 regulates its enzymatic activity.
Automatically generated - may contain errors
Lab products found in correlation
Antibody against β actin, by Merck Group (2 mentions)
Compound c, by Merck Group (2 mentions)
Phospho ampk t172, by Cell Signaling Technology (2 mentions)
Antibody against 6pgd, by Novus Biologicals (2 mentions)
Prediluted ki67 antibody, by Thermo Fisher Scientific (2 mentions)
1 hydroxy 8 methoxy anthraquinone s3, by Merck Group (2 mentions)
Physcion, by Santa Cruz Biotechnology (2 mentions)
A 769662, by LC Laboratories (2 mentions)
2 protocols using phospho acc1 s79
1
Stable Knockdown of 6PGD, G6PD, and AMPK
2
Stable Knockdown of 6PGD, G6PD, and AMPK
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stable KD of endogenous h6PGD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT -3’). The shRNA is designed to target the 3' non-coding region of h6PGD-A mRNA and shows no effect on the plasmid directed expression of 6PGD cDNA in cells. Stable KD of endogenous hG6PD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT-3’). Stable KD of endogenous hAMPK was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGCATAATAAGTCACAGCCAAACTCGAGTTTGGCTGTGACTTATTATGCTTTTT -3’). Antibodies against AMPK (cat# 5831), phospho-AMPK (T172) (cat# 2535), ACC1 (cat# 3662), and phospho-ACC1 (S79) (cat# 11818), G6PD (cat# 12263), and LKB1 (cat# 3050) were from Cell Signaling Technology (CST); antibody against 6PGD was from Novus (cat# NBP1-31589); antibody against β-actin was from Sigma (cat# A1978); prediluted Ki67 antibody was from Invitrogen (cat# 08-0156). Physcion was purchased from Santa Cruz Biotechnology. 1-hydroxy-8-methoxy-anthraquinone (S3) was purchased Sigma. DHEA was purchased from Calbiochem. DHA was purchased from TCI America. A769662 was purchased from LC Laboratories. Compound C was purchased from EMD Millipore.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!