Rock inhibitor y 27632 2hcl

Manufactured by Selleck Chemicals

Sourced in Finland

ROCK Inhibitor Y-27632 2HCl is a chemical compound used in research applications. It functions as a selective and potent inhibitor of the Rho-associated protein kinase (ROCK) enzyme.

Automatically generated - may contain errors

Lab products found in correlation

5 protocols using rock inhibitor y 27632 2hcl

Undirected Differentiation of hiPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

hiPSCs were cultured on Geltrex (Thermo Fisher) coated plates using: Essential 8 medium (Thermo Fisher). The culture was routinely monitored for mycoplasma contamination using a PCR assay, and 10 μm ROCK Inhibitor Y-27632 2HCl (Selleck Chemicals, #SEL-S1049) was added after cell splitting to promote survival. hiPSC cultures were kept in a humidified atmosphere of 5% CO₂ at 37°C and 5% oxygen. hiPSCs were undirectedly differentiated to a mixture of 3 lineages (ectodermal, endodermal, and mesodermal) by replacing Essential 8 medium with DMEM-F12 medium supplemented with 10% FBS for 7 days, and 10 μM ROCK Inhibitor Y-27632 2HCl (Selleck Chemicals) was added after cell splitting to promote survival.

Fasciani I., Petragnano F., Wang Z., Edwards R., Telugu N., Pietrantoni I., Zabel U., Zauber H., Grieben M., Terzenidou M.E., Di Gregorio J., Pellegrini C., Santini S J.r., Taddei A.R., Pohl B., Aringhieri S., Carli M., Aloisi G., Marampon F., Charlesworth E., Roman A., Diecke S., Flati V., Giorgi F., Amicarelli F., Tobin A.B., Scarselli M., Tokatlidis K., Rossi M., Lohse M.J., Annibale P, & Maggio R. (2024). The C-terminus of the prototypical M2 muscarinic receptor localizes to the mitochondria and regulates cell respiration under stress conditions. PLOS Biology, 22(4), e3002582.

+ Open protocol

+ Expand

Maintaining Undifferentiated Human iPSC Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human iPSC lines HuAiPSC‐A1¹⁹ and HuAiPSC‐A1‐RHD^−/− were cultured in Essential 8 (Gibco, Grand Island, NY) on Matrigel‐coated wells (Corning, New York). Cells were maintained daily and passaged every 4–6 days to maintain undifferentiated growth, as previously described.¹⁹ When colonies reached 70%–80% confluency, ReLeSR (StemCell Technologies, Vancouver, BC, Canada) was used to detach and dissociate large clones, and cells were passaged at a 1:10–1:20 ratio. Single cells were obtained using Accutase (StemCell Technologies) before plasmid transfection and fluorescence‐activated cell sorting (FACS). A rock inhibitor (Y‐27632 2HCl, Selleck, Houston, TX) was used to improve the cell survival rate during replating. All cultures were maintained at 37°C in a 5% CO₂ incubator (Thermo Scientific, Waltham, MA).

Xu L., Zeng Q., Liang L., Yang Z., Qu M., Li H., Zhang B., Zhang J., Yuan X., Chen L., Fan Z., He L., Nan X., Yue W., Xie X, & Pei X. (2023). Generation of Rh D‐negative blood using CRISPR/Cas9. Cell Proliferation, 56(11), e13486.

+ Open protocol

+ Expand

Neurosurgical Brain Tissue Harvest

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fifty-one surgically excised brain tissues were obtained from patients undergoing neurosurgery (Supplementary Tables 1 and 6). Informed consent (by the Health and Disabilities Ethics Committee New Zealand) was obtained from all donors, and the brain tissue was transported from the operating room to the laboratory in ice-cold transport medium, Hibernate^TM-A medium (Gibco), supplemented with 2% B27^® supplement (Invitrogen), and 10 µM ROCK inhibitor, Y-27632 2HCl (Selleckchem) in sterile falcon tubes (Falcon).

Park T.I., Schweder P., Lee K., Dieriks B.V., Jung Y., Smyth L., Rustenhoven J., Mee E., Heppner P., Turner C., Curtis M.A., Faull R.L., Montgomery J.M, & Dragunow M. (2020). Isolation and culture of functional adult human neurons from neurosurgical brain specimens. Brain Communications, 2(2), fcaa171.

+ Open protocol

+ Expand

CRISPR/Cas9-Mediated Knock-In in hESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human embryonic stem cells line (H9, WiCell, WIC-WA09-RB-001) was used for this study. hESCs were detached as single cells from the culture dishes with StemPro Accutase (Thermo Fisher A1110501) and washed with PBS. Cells were electroporated using the Neon transfection system (Invitrogen). A total of 2.5 × 10⁶ cells and plasmid mixture, containing Alt-R Cas9 nuclease, sgRNA targeting POGZ (TCTGATGGAGATTTGAGTGT TGG), electroporation enhancer, and the donor template plasmid (POGZ-miniIAA7-GFP), were electroporated in a 100-µL tip with 1100 V, 20 ms, and 2 × pulse settings. Electroporated hESCs were plated on Matrigel-coated 35-mm dishes in mTeSR medium containing 10 µM ROCK inhibitor Y-27632 2HCL (Selleckchem S1049) and 1 µM Alt-R HDR Enhancer. After 24 h, medium was changed to mTeSR medium without ROCK inhibitor or HDR enhancer, and the cells were further cultured until 72 h. The HDR efficiency was checked with FACS analysis. GFP + cells were single-cell sorted into 96-well plates, and clones were expanded and checked with gPCR for identifying homozygous or heterozygous tagging. One homozygously tagged clone was selected to introduce AtAFB2 (F74A)-SNAPf-weakNLS with BSD selection marker into AAVS1 locus by electroporation, followed by blasticidin selection for 2 weeks.

Li S., Wang Y., van der Stoel M., Zhou X., Madhusudan S., Kanerva K., Nguyen V.D., Eskici N., Olkkonen V.M., Zhou Y., Raivio T, & Ikonen E. (2024). HiHo-AID2: boosting homozygous knock-in efficiency enables robust generation of human auxin-inducible degron cells. Genome Biology, 25, 58.

+ Open protocol

+ Expand

Genome Editing of Human iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEL11.4, a previously characterized human iPSC line [Biomedicum Stem Cell Centre (BSCC)] (Mikkola et al., 2013 (link)) were grown in Stem Pro (Thermo Fisher Scientific) and were dissociated using Accutase (Life Technologies) and resuspended in cold 5% fetal bovine serum (FBS)/PBS. Three electroporations were performed using Neon Transfection system (Life Technologies) according to the manufacturer's instructions, with a total of 6×10E6 cells with 18 µg CAG-Cas9 (gift from Diego Balboa, Biomedicum Stem Cell Centre, Finland; Addgene plasmid #89995), 6 µg pUC-GNRH1-T2A-NLS-TdT-PGKPuro and 1.5 µg guide RNA using a pre-optimized program (1100V, 20 ms, 2 pulses) and plated onto Matrigel (Corning) matrix-coated dishes with 10 μM ROCK inhibitor (Y-27632 2HCl, Selleckchem) in Stem Pro (Life Technologies). On the following day, medium was changed to Stem Pro with 5 μM ROCK inhibitor. ROCK inhibitor was removed after 48 h, and selection with 0.15 µg/ml Puromycin (Sigma-Aldrich) was started 72 h after electroporation. Medium was refreshed daily until colonies established. Colonies were picked on Matrigel-coated 96-well plates in Stem Pro+5 µM Rock inhibitor ∼7-10 days after electroporation. All cell lines have been tested for mycoplasma contamination.

Lund C., Yellapragada V., Vuoristo S., Balboa D., Trova S., Allet C., Eskici N., Pulli K., Giacobini P., Tuuri T, & Raivio T. (2020). Characterization of the human GnRH neuron developmental transcriptome using a GNRH1-TdTomato reporter line in human pluripotent stem cells. Disease Models & Mechanisms, 13(3), dmm040105.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!