P mir reporter

Manufactured by Thermo Fisher Scientific

Sourced in United States

The P-miR-reporter is a laboratory instrument designed for the detection and quantification of microRNA (miRNA) expression levels. It utilizes a proprietary detection technology to provide accurate and reliable measurements of miRNA abundance in various biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

P-MIR-reporter plasmid P-MIR luciferase reporter vector P‐MIR‐reporter vectors

15 protocols using p mir reporter

Plasmid Generation and Modification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression plasmids for epitope‐tagged E2F1, SHP, and EID1 have been described.15, 19 The human HMGB2 3′ untranslated region (UTR) containing the predicted miR‐127 binding site was cloned into pMIR‐Reporter (Invitrogen) using primers 5′‐TCAGACTAGTCAAGTGCAGCTCAATACT‐3′ and 5′‐ACCAAGCTTCACCTGAGGAACAATT TA‐3′. Mutations in pMIR‐Reporter‐HMGB2‐3′UTR were generated with a SiteMutant kit using primers 5′‐TGAATTCAAGTGCAGCTCAATACTA GCTAGTGTATAAAAA
CTGTACAGATTTTTGTATAG‐3′ and 5′‐CT ATACAAAAATCTGTACAGTTTTTATACACT AGCTA
GTATTGAGCTGCACTTGAATTCA‐3′. The plasmids were confirmed by sequencing. The expression plasmid pTarget‐miR‐127 and pTarget‐miR‐433 were generated as described.11 Plasmids pCAG‐Myc‐Oct3/4‐IP and pCAG‐HA‐Sox2‐IP were gifts from Dr. Shinya Yamanaka. pCDNA3.1 Flag mHMGB2 and reporter gene plasmid 6xO/S luciferase (luc) were gifts from Dr. Yasuhiko Kawakam and Dr. Lisa Dailey, respectively.

Zhao Y., Yang Z., Wu J., Wu R., Keshipeddy S.K., Wright D, & Wang L. (2017). High‐mobility‐group protein 2 regulated by microRNA‐127 and small heterodimer partner modulates pluripotency of mouse embryonic stem cells and liver tumor initiating cells. Hepatology Communications, 1(8), 816-830.

+ Open protocol

+ Expand

Plasmid construction and mutagenesis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression plasmids for epitope-tagged E2F1, SHP and EID1 have been previously described (15 (link), 19 (link)). The human HMGB2 3′UTR containing the predicted miR-127 binding site was cloned into pMIR-Reporter (Invitrogen) using primers 5′-TCAGACTAGTCAAGTGCAGCTCAATACT-3′ and 5′-ACCAAGCTTCACCTGAGGAACAATTTA-3′. Mutations in pMIR-Reporter-HMGB2-3′UTR were generated with a SiteMutant Kit using primers 5′-TGAATTCAAGTGCAGCTCAATACTAGCTAGTGTATAAAAACTGTACAGATTTTTGTATAG-3′ and 5′-CTATACAAAAATCTGTACAGTTTTTATACACTAGCTAGTATTGAGCTGCACTTGAATTCA-3′. The plasmids were confirmed by sequencing. The expression plasmid pTarget-miR-127 and pTarget-miR-433 were generated as described (11 (link)). Plasmid pCAG-Myc-Oct3/4-IP, pCAG-HA-Sox2-IP were gifts from Dr. Shinya Yamanaka. pCDNA3.1 Flag mHMGB2 and reporter gene plasmid 6xO/S luc were gifts from Drs. Yasuhiko Kawakam and Lisa Dailey, respectively.

+ Open protocol

+ Expand

miR-629-5p Regulation of CXXC4 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The potential target genes of miR-629-5p were analyzed by online software TargetScan 7.1 (http://www.targetscan.org/vert_71/). The native or mutant 3′UTR of CXXC4 was amplified and cloned into plasmid pMIR-Reporter (Thermo Fisher), generating the plasmids pMIR-wt and pMIR-mut, respectively. The generated vectors were cotransfected with miR-629-5p mimic, miR-629-5p inhibitor, mimic Con, or inhibitor Con into LoVo cells. After 48 h, the luciferase activity was determined by the Dual-Luciferase Reporter Assay System (Promega, WI, U.S.A.). The relative firefly luciferase activity was presented by normalizing to Renilla luciferase activity.

Lu J., Lu S., Li J., Yu Q., Liu L, & Li Q. (2018). MiR-629-5p promotes colorectal cancer progression through targetting CXXC finger protein 4. Bioscience Reports, 38(4), BSR20180613.

+ Open protocol

+ Expand

Validation of miR-140-5p Binding to WNT1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Binding sites between miR-140-5p and WNT1 were first predicted on the Bioinformatics & Research Computing website (www.targetscan.org) and the fragment sequence containing the binding sites was obtained. Synthetic WNT1-WT or WNT1-MUT was inserted into the 3ʹUTR of the pMIR-reporter (Thermo Fisher Scientific, Waltham, USA) to package recombinant plasmids pMIR-WNT1-WT and pMIR-WNT1-MUT, respectively. Correctly identified recombinant plasmids WNT1-WT or WNT1-MUT were co-transfected into HEK293T cells with miR-140-5p or NC plasmids, respectively. After incubating for 48 h, cells were cleaved in 1 × passive lysate, and luciferase activity was assessed using a luciferase test kit (Promega, Madison, USA) using a dual-luciferase reporter assay system (Promega). The related target effect was shown as relative luciferase activity (the ratio of firefly luciferase intensity to that of renilla). Renilla luciferase activity was used as the internal reference.

Wu Y., Li J., Chen S, & Yu Z. (2020). The effects of miR-140-5p on the biological characteristics of ovarian cancer cells through the Wnt signaling pathway. Advances in clinical and experimental medicine : official organ Wroclaw Medical University, 29(7).

+ Open protocol

+ Expand

Validation of CASP8 as miR-212 Target

Check if the same lab product or an alternative is used in the 5 most similar protocols

The target relationship of miR-212 and CASP8 was predicted by the use of starBase. The luciferase reporter vectors WT-CASP8 and MUT-CASP8 were generated by inserting the wild-type or mutant 3′UTR sequence of CASP8 containing the miR-212-binding sites into the pMIR reporter (Thermo Fisher). HaCaT cells were cotransfected with WT-CASP8, MUT-CASP8, or control vector and NC mimic, miR-212 mimic, NC inhibitor or miR-212 inhibitor for 24 h. Luciferase activity was detected with a dual-luciferase analysis kit (Promega, Madison, WI, USA).

Liu Y., Xiong W., Wang C.W., Shi J.P., Shi Z.Q, & Zhou J.D. (2021). Resveratrol promotes skin wound healing by regulating the miR-212/CASP8 axis. Laboratory investigation; a journal of technical methods and pathology, 101(10).

+ Open protocol

+ Expand

Characterization of miR-16 Binding on Tie2 CDS

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The binding sequence for the miR-16 family on Tie2 CDS was identified using miRcode software. The binding site is in position chr9: 27204938–27204943. At 450 bp to either side of the binding site was cloned in pMIR-Reporter (Life Technologies). Primers used for the cloning were as follows: Tie2 CDS, forward 5′-ATAGTGGTTAGGTGGCAGGG-3′ and reverse 5′-CTGCCTGTACTTGGACTTGC-3′. Primers for 3′ UTR mutation were as follows: Tie2 CDS, forward 5′-AGGGGGGAAGAATAATAAATTAGCCATCCTTGG-3′ and reverse 5′-CCAAGGATGGCTAATTTATTATTCTTCCCCCCT-3′.
Luciferase assays were performed as previously described.²⁴ (link) Briefly, luciferase constructs were transfected into HEK293T cells together with miR-15 and/or miR-16 mimics or p-SV-β-gal control vector. Cells were cultured for 48 h and assayed with the Luciferase and β-Galactosidase Reporter Assay Systems (Promega, E1500 and E2000, respectively). Luciferase values were normalized to protein concentration and β-galactosidase activity.

Besnier M., Shantikumar S., Anwar M., Dixit P., Chamorro-Jorganes A., Sweaad W., Sala-Newby G., Madeddu P., Thomas A.C., Howard L., Mushtaq S., Petretto E., Caporali A, & Emanueli C. (2019). miR-15a/-16 Inhibit Angiogenesis by Targeting the Tie2 Coding Sequence: Therapeutic Potential of a miR-15a/16 Decoy System in Limb Ischemia. Molecular Therapy. Nucleic Acids, 17, 49-62.

+ Open protocol

+ Expand

Luciferase Assay for 3' UTR Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Luciferase assay has been performed as previously described.⁵⁰ (link) TGFB2 3′ UTR and SMAD2 3′ UTR vectors were cloned in pMIR-Reporter (Life Technologies). Primers are used for the cloning are as follows: TGF-β2 3′ UTR, forward 5′-ATAAAGCTTATTTGCCACATCATTGCAGA-3′, reverse 5′-ATAACTAGTGGGAATAAAAAGACGGCACA-3′; SMAD2 3′ UTR, forward 5′-ATAAAGCTTTGATCCAGCTAAGGTAACTGATGTT-3′; reverse 5′-ATAACTAGTTGGTAAACAACTCAAATGGCTTTC-3′. Primers for 3′ UTR mutation are as follows: TGFB2, forward 5′-ATAAAGCTTATTTGCCACATCATTGCAGA-3′ and reverse 5′-ATAACTAGTCCTATCTGAGAGGAAAATGTCTGC-3′; SMAD2, forward 5′-ATAAAGCTTTGATCCAGCTAAGGTAACTGATGTT-3′ and reverse 5′-ATAACTAGTGGACTTCCAGAGGGAAACAA-3′. Luciferase constructs were transfected into HEK293T cells or HUVECs together with miR-148b mimics or p-SV-β-gal control vector. Cells were cultured for 48 hr and assayed with the Luciferase and β-Galactosidase Reporter Assay Systems (Promega). Luciferase values were normalized to protein concentration and β-galactosidase activity.

Miscianinov V., Martello A., Rose L., Parish E., Cathcart B., Mitić T., Gray G.A., Meloni M., Al Haj Zen A, & Caporali A. (2018). MicroRNA-148b Targets the TGF-β Pathway to Regulate Angiogenesis and Endothelial-to-Mesenchymal Transition during Skin Wound Healing. Molecular Therapy, 26(8), 1996-2007.

+ Open protocol

+ Expand

Dual-Luciferase Assay for miR-133a Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

The putative miR-133a target binding sequence in ABHD11-AS1 and its mutant of the binding sites was amplified by PCR and the PCR products were cloned into pMirReporter plasmid (Promega, Madison, USA) to form the ABHD11-AS1-wild-type (WT-ABHD11-AS1) vector and ABHD11-AS1-mutated-type (MUT-ABHD11-AS1). Similarly, the SOX4-wild-type (WT-SOX4) and SOX4-mutated-type (MUT-SOX4) reporter vectors were constructed. Subsequently, mutated or wild-type pMirReporter luciferase vector and miR-133a mimic or NC-mimic were cotransfected into HEK-293 cells in 96-well plates for 24 h with Lipofectamine 3000 (Invitrogen). The luciferase activity was determined by the luciferase reporter assay system (Promega) according to the manufacture’s instruction.

Lei X., Li L, & Duan X. (2018). Long non-coding RNA ABHD11-AS1 promotes colorectal cancer development through regulation of miR-133a/SOX4 axis. Bioscience Reports, 38(6), BSR20181386.

+ Open protocol

+ Expand

Validating HOXD9-miR-205 Regulatory Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

TargetScan [16 (link)] was used to predict the binding site between the 3′-UTR of HOXD9 and miR-205. The 3′-UTR of HOXD9 was amplified from human cDNA using PCR. To mutate the miR-205 binding site, the 3′-UTR of HOXD9 (AAUGAAGG) was replaced by TTACTTCC. The PCR products were inserted into pMIR REPORTER (Ambion, Austin, TX, U.S.A.) using Sac I and Hind III. Successful ligation was validated by sequencing. HEK-293T cells, which were seeded into 24-well plates, were co-transfected with the wild-type or mutated HOXD9 3′-UTR reporter plasmids and a control Renilla luciferase pRL-TK vector. After 48 h, luciferase assays were performed using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, U.S.A.). Values were normalized to Renilla luciferase activity. All assays were performed in triplicate.

Dai B., Zhou G., Hu Z., Zhu G., Mao B., Su H, & Jia Q. (2019). MiR-205 suppresses epithelial–mesenchymal transition and inhibits tumor growth of human glioma through down-regulation of HOXD9. Bioscience Reports, 39(5), BSR20181989.

+ Open protocol

+ Expand

Validating miR-29c-5p Target TMEM98

Check if the same lab product or an alternative is used in the 5 most similar protocols

TargetScan was utilized to identify targets of miR-29c-5p. The 3´-UTR of wild-type (WT) human TMEM98, which contains a putative miR-29c-5p DNA-binding sequence, was amplified using PCR, and the amplicon was inserted into the p-miR-reporter (Ambion, USA) to create a TMEM98-WT luciferase vector. The mutant (MUT) 3´-UTR was inserted into the p-miR-reporter to create a TMEM98-MUT luciferase vector. The WT 3´-UTR or MUT 3´-UTR of TMEM98 or the miR-29c-5p mimic was used to cotransfect FaDu cells in the presence of Lipofectamine 3000. After 48 h, luciferase activity was measured using a dual luciferase reporter assay system according to the manufacturer's instructions.

Li J., Chen W., Luo L., Liao L., Deng X, & Wang Y. (2020). The microRNA miR-29c-5p inhibits cell proliferation and migration by targeting TMEM98 in head and neck carcinoma. Aging (Albany NY), 13(1), 769-781.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!