NF-κB gel-shift oligonucleotide (5′-AGTTGAGGGGACTTTCCCAGGC-3′) and AP-1 gel-shift oligonucleotide (5′-CGCTTGATAGTCAGCCGGAA-3′; Promega Corp, Madison, WI, USA) were labeled with [32P]-dATP (Amersham Bioscience, Piscataway, NJ, USA), using T4 polynucleotide kinase (Promega Corp). End-labeled probe was purified from unincorporated [32P]-dATP using a purification column (Amersham Biosciences, Buckinghamshire, UK) and recovered in Tris-EDTA buffer (TE). Nuclear extracts (5 μg) were preincubated in buffer containing 12% glycerol, 12 mM HEPES, pH 7.9, 4 mM Tris-HCl, pH 7.9, 1 mM EDTA, 1 mM DTT, 25 mM KCl, 5 mM MgCl2, 0.04 μg/mL Poly (dI-dC) · Poly (dI-dC) (Amersham Bioscience), 0.4 mM PMSF, and TE. The labeled probe was added and the samples were incubated for 30 min at room temperature. The samples were subjected to electrophoretic separation at 4°C on a nondenaturing 5% acrylamide gel. The gel was dried at 80°C for 40 min and exposed to a radiography film for 6–18 h at −80°C with intensifying screens.
32p datp
Manufactured by Cytiva
Sourced in United States
[32P]-dATP is a radioactively labeled nucleotide analog that can be used in various molecular biology applications. It is commonly used as a tracer in DNA synthesis, labeling, and detection experiments.
Automatically generated - may contain errors
Lab products found in correlation
32p datp, by Bio-Rad (5 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (5 mentions)
Polynucleotidylkinase, by Roche (3 mentions)
Purification column, by Bio-Rad (3 mentions)
Nf κb gel shift oligonucleotide, by Promega (3 mentions)
Ap 1 gel shift oligonucleotide, by Promega (3 mentions)
Poly d 1 c, by Merck Group (1 mentions)
T4 polynucleotide kinase, by Promega (1 mentions)
Poly di dc poly di dc, by Cytiva (1 mentions)
Hybond membrane, by Cytiva (1 mentions)
10 protocols using 32p datp
1
Electrophoretic Mobility Shift Assay for NF-κB and AP-1
2
Electrophoretic Mobility Shift Assay (EMSA)
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EMSA was performed essentially as described60 (link). Briefly, a dsDNA probe containing a consensus C/EBP site was end-labeled with [32P]dATP (Amersham) and polynucleotidylkinase (Roche). DNA-binding assays were carried out in a 25 μl reaction containing 5–10 μg nuclear extract, 20 mM HEPES (pH 7.9), 200 mM NaCl, 5% Ficoll, 1 mM EDTA, 50 mM DTT, 0.01% Nonidet P-40, 1.75 μg poly(dI-dC), and 2×104 cpm probe. After incubation at room temperature for 20 min, 10–15 μl of the binding reaction was loaded onto a 6% polyacrylamide gel in TBE (90 mM Tris base, 90 mM boric acid, 0.5 mM EDTA) buffer and electrophoresed at 160 V for 2 h. Supershift assays were carried out by pre-incubating the nuclear extract with 1 μl of the appropriate antibody at 4°C for 30 min before adding the binding reaction mixture.
3
Radiolabeling and Gel Shift Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NF-κB gel shift oligonucleotide (5’-ACTTGAGGGGACTTTCCCAGGGC-3’) and the PPAR gel shift oligonucleotide (5’-CAAAACTAGGTCAAAGCTCA-3’; sc-2587, Santa Cruz Biotechnology, Santa Cruz, CA, USA) were radiolabeled using [32P]-dATP (Amersham Biosciences, Piscataway, NJ, USA) and T4 polynucleotide kinase (GIBCO, Grand Island, NY, USA). The radiolabeled oligonucleotide was separated from unconsumed [32P]-dATP using a Bio-Rad purification column (Bio-Rad Laboratories) eluted with Tris-EDTA buffer. Nuclear extracts of the cells were incubated with the [32P]-labeled oligonucleotide in buffer containing 12% glycerol, 12 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM DTT, 25 mM KCl, 5 mM MgCl2, 0.04 μg/mL poly[d(I-C)] at room temperature for 30 min. The samples were subjected to electrophoretic separation at 4 °C on a nondenaturing, 5% acrylamide gel. The gel was dried at 80 °C for 2 h after which it was exposed at −80 °C to a radiography film using intensifying screens.
4
NF-κB and AP-1 Gel Shift Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A NF-κB gel shift oligonucleotide (AGTTGAGGGGACTTTCCCAGGC) and a AP-1 gel-shift oligonucleotide (CGCTTGATA GTCAGCCGGAA) (all from Promega, Madison, WI, USA) were labeled with [32P] dATP (Amersham) using the T4 polynucleotide kinase (GIBCO, Grand Island, NY, USA). The end-labeled probe was purified from an unincorporated [32P] dATP using a Bio-Rad purification column (Bio-Rad Laboratories) and recovered in Tris-EDTA buffer (TE). Nuclear extracts (3 μg) were incubated with the buffer containing 32P-labeled NF-κB or AP-1 consensus oligonucleotide for 30 min and subjected to electrophoretic separation on a nondenaturing acrylamide gel. The gels were dried at 80°C for 2 h and exposed to a radiography film for 6–18 h at −70°C with intensifying screens [28 ].
5
Electrophoretic Mobility Shift Assay (EMSA)
6
Electrophoretic Mobility Shift Assay for C/EBP
7
NF-κB Gel Shift Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NF-κB gel shift oligonucleotide (5’-ACTTGAGGGGACTTTCCCAGGGC-3’) (Promega) was radiolabeled using [32P]-dATP (Amersham Biosciences, Piscataway, NJ, USA) and T4 polynucleotide kinase (GIBCO, Grand Island, NY, USA). The radiolabeled oligonucleotide was separated from unconsumed [32P]-dATP using a Bio-Rad purification column (Bio-Rad Laboratories, Hercules, CA, USA) eluted with Tris-EDTA buffer (pH 7.5). AGS cell nuclear extracts were incubated at 25 °C for 30 min with the [32P]-labeled oligonucleotide in buffer containing 12% glycerol, 12 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM DTT, 25 mM KCl, 5 mM MgCl2, and 0.04 μg/mL poly[d(I-C)] (Sigma-Aldrich, St. Louis, MO, USA). The samples were subjected to electrophoretic separation at 4 °C on a nondenaturing, 5% acrylamide gel. The gel was dried at 80 °C for 2 h after which it was exposed at –80 °C to a radiography film enhanced by an intensifying screen.
8
Gel-Shift Assay for PPAR-γ and AP-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PPAR-γ gel-shift oligonucleotide (5′-CAAAACTAGGTCAAAGCTCA-3′; sc-2587, Santa Cruz Biotechnology, Dallas, TX, USA) and AP-1 gel-shift oligonucleotide (5′-CGCTTGATAGTCAGCCGGAA-3′; Promega) were radiolabeled using [32P]-dATP (Amersham Biosciences, Piscataway, NJ, USA) and T4 polynucleotide kinase (GIBCO, Grand Island, NY, USA). The radiolabeled oligonucleotides were separated from free [32P]-dATP using Bio-Rad purification columns (Bio-Rad Laboratories, Hercules, CA, USA). Nuclear extracts were incubated at room temperature for 30 min under the following conditions: [32P]-labeled oligonucleotide in buffer containing 12% glycerol, 12 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM DTT, 25 mM KCl, 5 mM MgCl2, and 0.04 µg/mL poly[d(I-C)]. The samples were electrophoretically separated in a nondenaturing 5% acrylamide gel. The gel was dried at 80 °C for 2 h and exposed to a radiography film at −80 °C with intensifying screens.
9
Gorilla Genomic DNA Preparation and Southern Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNAs from gorilla lymphoblastoid cell lines were prepared by standard procedures70 . Endonuclease digestions were performed using a 4-fold excess of enzyme under the conditions suggested by the suppliers. Gel electrophoresis was performed in 1X tris-acetate (1X TAE 540 mM Tris-acetate, 1mMethylenediaminetetraacetic acid, EDTA). Genomic DNAs were run in a 0.8% agarose gel for 16–18 h, denatured, and DNA transferred to Hybond membrane (Amersham), using as transfer buffer NaOH/NaCl (sodium chloride NaOH 0.25 M, sodium cloride NaCl 1.5 mM).
Clone inserts (50 ng) were labeled with 32P-dATP (3,000 Ci/mmol; Amersham) by using random oligomer priming. Filters were exposed and developed using storm imaging system.
Clone inserts (50 ng) were labeled with 32P-dATP (3,000 Ci/mmol; Amersham) by using random oligomer priming. Filters were exposed and developed using storm imaging system.
10
NF-κB DNA Binding Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NF-κB-DNA binding activity was determined as previously described [24 (link)]. Briefly, the NF-κB gel shift oligonucleotide (5′-ACTTGAGGGGACTTTCCCAGGGC-3′) was radiolabeled using [32P]-dATP (Amersham Biosciences, Piscataway, NJ, USA) and T4 polynucleotide kinase (GIBCO, Grand Island, NY, USA). The radiolabeled oligonucleotide was separated from unconsumed [32P]-dATP using a Bio-Rad purification column (Bio-Rad Laboratories) and eluted with Tris-EDTA buffer. Nuclear extracts of the cells were incubated with the [32P]-labeled oligonucleotide in buffer containing 12% glycerol, 12 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM DTT, 25 mM KCl, 5 mM MgCl2, and 0.04 μg/mL poly[d(I-C)] at 20–22°C for 30 min. The samples were subjected to electrophoretic separation at 4°C on a nondenaturing 5% acrylamide gel. The gel was dried at 80°C for 2 h, followed by exposure at -80°C to a radiography film using an intensifying screen.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!