Log In Sign up
The largest database of trusted experimental protocols

Agilent bioanalyzer rna 6000 pico chip

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Agilent Bioanalyzer RNA 6000 Pico chip is a lab equipment designed for the analysis of small amounts of RNA samples. It provides automated, electrophoretic separation and detection of RNA fragments based on their size.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (6 mentions) Trizol reagent, by Thermo Fisher Scientific (6 mentions) Sybr green, by Eurogentec (3 mentions) Nucleospin rna xs kit, by Macherey-Nagel (3 mentions) Taqman kit, by Thermo Fisher Scientific (1 mentions)

3 protocols using agilent bioanalyzer rna 6000 pico chip

1

Isolation and Quantification of EV-RNA in UC-HSPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total EV‐RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. RNA concentration was determined using Nanodrop (Thermo Fisher Scientific) and size distribution was checked on an Agilent Bioanalyzer RNA 6000 Pico chip (Thermo Fisher Scientific). RNA from CD34+UC‐HSPCs was isolated using NucleoSpin RNA XS kit (Macherey‐Nagel, Duren, Germany) according to the manufacturer's instructions. Quantitative real‐time PCR was performed using the SYBR Green (Eurogentec, Seraing, Belgium) kit, according to the manufacturer's instructions. The following primer sequences were used:
Gene symbolForward sequence (5' → 3')Reverse sequence (5' → 3')
CYSLTR2GCAGCTGAAAGACAGAGACCTCCATACCTTGCATGGACCTTCT
EGR1AGCCCTACGAGCACCTGACTGGGTTGGTCATGCTCACTA
GAPDHCCGCATCTTCTTTTGCGTCGCCCAATACGACCAAATCCGTTG
ITGAXCCTACGGAACCACCATCACCACATGTCAGGTGCAGGGAAC
MAOAATGACACCAAGCCAGATGGGAAGTCGATCAGCTTTCCGGG
NFIBGTCCAGCCACATCATATCACAGTTGGCAGGATCATTGTGGCTT
S100A9GGAATTCAAAGAGCTGGTGCGAGCTGCTTGTCTGCATTTGTG
Morhayim J., Ghebes C.A., Erkeland S.J., ter Borg M.N., Hoogenboezem R.M., Bindels E.M., van Alphen F.P., Kassem M., van Wijnen A.J., Cornelissen J.J., van Leeuwen J.P., van der Eerden B.C., Voermans C., van de Peppel J, & Braakman E. (2020). Identification of osteolineage cell‐derived extracellular vesicle cargo implicated in hematopoietic support. The FASEB Journal, 34(4), 5435-5452.
+ Open protocol
+ Expand
2

Isolation and Analysis of Extracellular Vesicle RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The purified EV pellet was incubated with or without RNase A (100 mM) and synthetic miR-1 (20 pM) at 37 °C for 30 minutes, and total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA concentration was determined using Nanodrop (Thermo Fisher Scientific) and size distribution was checked on an Agilent Bioanalyzer RNA 6000 Pico chip (Thermo Fisher Scientific). RNA from CD34+ cells was isolated using NucleoSpin RNA XS kit (Macherey-Nagel, Duren, Germany) according to the manufacturer’s instructions. Quantitative real-time PCR for mRNAs and miRNAs were performed using the SYBR® Green (Eurogentec, Seraing, Belgium) and Taqman® kits (Thermo Fisher Scientific), respectively, according to the manufacturer’s instructions. The primer sequences are listed in Supplementary Table S1.
Morhayim J., van de Peppel J., Braakman E., Rombouts E.W., ter Borg M.N., Dudakovic A., Chiba H., van der Eerden B.C., Raaijmakers M.H., van Wijnen A.J., Cornelissen J.J, & van Leeuwen J.P. (2016). Osteoblasts secrete miRNA-containing extracellular vesicles that enhance expansion of human umbilical cord blood cells. Scientific Reports, 6, 32034.
+ Open protocol
+ Expand
3

EV-RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total EV-RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA concentration was determined using Nanodrop (Thermo Fisher Scientific) and size distribution was checked on an Agilent Bioanalyzer RNA 6000 Pico chip (Thermo Fisher Scientific). RNA from CD34+ UC-HSPCs was isolated using NucleoSpin RNA XS kit (Macherey-Nagel, Duren, Germany) according to the manufacturer’s instructions. Quantitative real-time PCR was performed using the SYBR® Green (Eurogentec, Seraing, Belgium) kit, according to the manufacturer’s instructions. The following primer sequences were used:
Morhayim J., Ghebes C.A., Erkeland S.J., ter Borg M.N., Hoogenboezem R.M., Bindels E.M., van Alphen F.P., Kassem M., van Wijnen A.J., Cornelissen J.J., van Leeuwen J.P., van der Eerden B.C., Voermans C., van de Peppel J, & Braakman E. (2020). Identification of osteolineage cell‐derived extracellular vesicle cargo implicated in hematopoietic support. The FASEB Journal, 34(4), 5435-5452.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!