Pgl2 promoter

To construct the WWTR1-HRE and SIAH1-HRE reporters, 55-bp double-stranded oligonucleotides were inserted between the BamHI and SalI sites of pGL2-Promoter (Promega). All plasmid constructs were confirmed by nucleotide sequence analysis. A 247-bp CTGF promoter sequence was amplified from human genomic DNA by PCR (primers: 5′-CCCCTCGAGAGTGTGCCAGCTTTTTCAGAC-3′ and 5′-CGAAGCTTCGAGCTGGAGGGTGGAGT-3′), purified by gel extraction, and inserted into the XhoI and HindIII sites of pGL2-Basic (Promega). For HRE reporter assays [48 (link)], cells were seeded onto 48-well plates and co-transfected with recombinant pGL2-Promoter plasmid, which contained HRE-WT or HRE-MUT sequences, and pSV-Renilla. Transfected cells were exposed to 20% or 1% O₂ for 24 h. Firefly luciferase and Renilla luciferase activities in cell lysates were determined using the Dual-Luciferase Assay System (Promega).

The plasmid constructs, including NRF2-HA-pcDNA3, wild type and mutant FLAG-KEAP1-pcDNA3.1 and V5-KEAP1-pcDNA3.1, CUL3-V5-pcDNA3, CUL3-HA-pcDNA3 [18 (link), 19 (link)]. The Antioxidant Response Element (ARE)-luciferase-pGL2 reporter plasmid was a kind gift from Dr. Alan Porter [20 (link)]. The reporter plasmid contains one binding site for the NRF2/Maf heterodimeric transcription factor. The plasmid was generated by amplifying the 25bp sequence (GCAGTCACAGTGACTCAGCAGAATC) of the antioxidant response element upstream of the Nqo1 gene (NCBI# M81596) from SH-Sy5y cells genomic DNA. The amplified product was cloned into the NheI and XhoI sites of pGL2 Promoter (Promega) reporter plasmid. To generate the FLAG-KEAP1 KLHL12 BTB plasmid, a modified pcDNA3.1 backbone with an N-terminal 2xFLAG tag, followed by KpnI and XbaI restriction sites, was used. The KEAP1 KLHL12 BTB insert was cloned into the KpnI and XbaI restriction sites and consisted of the KEAP1 N-terminal (NT) region (KEAP1 amino acids 2–60), followed by the KLHL12 BTB domain (KLHL12 amino acids 33–128) and the KEAP1 intervening region (IVR) and double-glycine repeat domain (DGR) and the C-terminal (CT) region (KEAP1 amino acids 180–624). The plasmids denoted ΔNT lack the KEAP1 N-terminal region (amino acids 1–60).